SubtiBank SubtiBank
cotW
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

cotW

spore crust protein (insoluble fraction), formation of the spore crust
locus
BSU_11770
pI
9.95
mw
12.20 kDa
protein length
105 aa Sequence Blast
gene length
318 bp Sequence Blast
function
resistance of the spore
product
spore crust protein (insoluble fraction)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.5|Class V]
  • Gene

    Coordinates
    1,251,273 1,251,590

    The protein

    [SW|Localization]

  • spore crust, localization depends on [protein|905148CAF82018E7F8E800FDF3F41163AAA8E682|CotX], [protein|B2636947990A303C43CEA8BFBE38811DD233A0A6|CotY], and [protein|B3BA3A44C3EE2747FB594BD7199864E9ECA953CB|CotZ] [Pubmed|23202530]
  • Expression and Regulation

    Operons

    genes
    [gene|63870866AA2EA1727D77609B330FCD9704007679|cotV]-[gene|47669BC8073FB0F9799E06BB9FC39700F960910E|cotW]-[gene|905148CAF82018E7F8E800FDF3F41163AAA8E682|cotX]
    description
    [Pubmed|7519271]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,7519271], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15383836], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|7519271,15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE], [protein|search|SigK], [protein|search|GerE], [SW|SpoIIID]) [Pubmed|15383836]
  • view in new tab

    Biological materials

    Mutant

  • BKE11770 ([gene|47669BC8073FB0F9799E06BB9FC39700F960910E|cotW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTTTTCACCTCGTCT, downstream forward: _UP4_TAGCCAATCATAAAAAATAG
  • BKK11770 ([gene|47669BC8073FB0F9799E06BB9FC39700F960910E|cotW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTTTTCACCTCGTCT, downstream forward: _UP4_TAGCCAATCATAAAAAATAG
  • References

    Reviews

  • 23202530
  • Original publications

  • 7519271,19304857,21665972,12107147,15383836,22171814,25872412,27766092,28870294,30582883