SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to [SW|ABC transporter] (ATP-binding protein)
26.36 kDa
protein length
236 aa Sequence Blast
gene length
711 bp Sequence Blast
[SW|ABC transporter] (ATP-binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Exporters] → [category|SW|Exporters of unknown function]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,071,400 3,072,110

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|59A7B26F810D7FEB07C176A8B2ECF6B83803DE49|EcsA]
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 4-255) (according to UniProt)
  • Structure

  • [PDB|4RVC] (from Geobacillus kaustophilus, 44% identity) [pubmed|25724946]
  • Expression and Regulation



    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11866510,12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • expressed under conditions of cell wall stress ([protein|search|SigW]) [Pubmed|11866510,12207695]
  • view in new tab

    Biological materials


  • MGNA-A817 (ythP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE30010 ([gene|47C1A154AF6F67CA507A9F4FEA9576E7131EFB6D|ythP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAACTCACTCACCTCCAA, downstream forward: _UP4_AAGGCAGTTCAAGGTGATCG
  • BKK30010 ([gene|47C1A154AF6F67CA507A9F4FEA9576E7131EFB6D|ythP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAACTCACTCACCTCCAA, downstream forward: _UP4_AAGGCAGTTCAAGGTGATCG
  • References

  • 10092453,11866510,12207695,25724946