SubtiBank SubtiBank
ybcM
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ybcM

similar to glucosamine-fructose-6-phosphate aminotransferase
locus
BSU_01900
pI
4.79
mw
11.42 kDa
protein length
104 aa Sequence Blast
gene length
315 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.26|Utilization of pectin]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.4|Prophage 1]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    213,155 213,469

    The protein

    Structure

  • [PDB|4S1W] (from Staphylococcus aureus, 39.5% identity)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-C511 (ybcM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2509 NBRP B. subtilis, Japan]
  • BKE01900 ([gene|47E3AEE400EC9505C7C7DB07BF172E4FA957F708|ybcM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAGCTTCAGTGCACCT, downstream forward: _UP4_TAAGATGTTTAACCCCTCTG
  • BKK01900 ([gene|47E3AEE400EC9505C7C7DB07BF172E4FA957F708|ybcM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAGCTTCAGTGCACCT, downstream forward: _UP4_TAAGATGTTTAACCCCTCTG
  • References

  • 17449691