SubtiBank SubtiBank
ybcM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ybcM

similar to glucosamine-fructose-6-phosphate aminotransferase
locus
BSU_01900
pI
4.79
mw
11.42 kDa
protein length
104 aa Sequence Blast
gene length
315 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.26|Utilization of pectin]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.4|Prophage 1]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    213,155 213,469

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-C511 (ybcM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2509 NBRP B. subtilis, Japan]
  • BKE01900 ([gene|47E3AEE400EC9505C7C7DB07BF172E4FA957F708|ybcM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAGCTTCAGTGCACCT, downstream forward: _UP4_TAAGATGTTTAACCCCTCTG
  • BKK01900 ([gene|47E3AEE400EC9505C7C7DB07BF172E4FA957F708|ybcM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAGCTTCAGTGCACCT, downstream forward: _UP4_TAAGATGTTTAACCCCTCTG
  • References

  • 17449691