SubtiBank SubtiBank
tenA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

tenA

thiaminase II
locus
BSU_11650
pI
4.99
mw
27.27 kDa
protein length
236 aa Sequence Blast
gene length
711 bp Sequence Blast
function
thiamine salvage
product
thiaminase II
essential
no
ec
3.5.99.2
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.3|Biosynthesis/ acquisition of thiamine]
  • Gene

    Coordinates
    1,242,449 1,243,159

    The protein

    Catalyzed reaction/ biological activity

  • 4-amino-5-aminomethyl-2-methylpyrimidine + H2O --> 4-amino-5-hydroxymethyl-2-methylpyrimidine + NH4+(according to UniProt)
  • H2O + thiamine --> 4-amino-5-hydroxymethyl-2-methylpyrimidine + 5-(2-hydroxyethyl)-4-methylthiazole + H+ (according to UniProt)
  • Protein family

  • TenA family (single member, according to UniProt)
  • Structure

  • [PDB|1YAF], [PDB|2QCX] (complex with formyl aminommethyl pyrimidine)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|47E47FB7D9C079DF603906694C4649A049814346|tenA]-[gene|CA6AAE8AC5B5EF01A911B035F8782579CD876C08|tenI]-[gene|87B5C84B7EE10F60B545CCFEF6A527A546B80432|thiO]-[gene|95DA3F899037140F48B99E065C768356CE08FA94|thiS]-[gene|B58B8F260E446E28BC2E3A9AA84EA771EC0A8634|thiG]-[gene|CCD3DDE9E52FCD4906735059CF30593BEB56FD1B|thiF]-[gene|97EDB4ACD64C5FA2E6014ED133DF18F602FF58BB|thiD]
    description
    [Pubmed|1898926]

    regulatory mechanism

  • [protein|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box]: [SW|RNA switch], via [SW|RNA switch], in [regulon|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box regulon]
  • regulation

  • repressed by thiamine ([SW|Thi-box]) [Pubmed|16356850]
  • the [SW|Thi-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE11650 ([gene|47E47FB7D9C079DF603906694C4649A049814346|tenA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAATCATTCCCCCTCTG, downstream forward: _UP4_AATGTGGAGCTTCACGCCAT
  • BKK11650 ([gene|47E47FB7D9C079DF603906694C4649A049814346|tenA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAATCATTCCCCCTCTG, downstream forward: _UP4_AATGTGGAGCTTCACGCCAT
  • References

    Reviews

  • 10382260
  • Original publications

  • 15709744,18054064,17618314,16356850,24311574,15378759,29794222