SubtiBank SubtiBank
ydgA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ydgA

unknown
locus
BSU_05560
pI
4.17
mw
8.28 kDa
protein length
gene length
243 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    602,185 602,427

    Expression and Regulation

    Operons

    genes
    [gene|68E585F6670539982E8E8032337DA2043C67FCC4|ydgB]-[gene|483587EB658850D786C3C95C02D419994FCC9F45|ydgA]-[gene|8F85E6DE353F29759301A463335BFC15F829E2D0|cotP]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|9068633], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during sporulation ([protein|6FAD8804AA32B84819DDE57C0AF63F208FB9FFD1|SigKC]) [Pubmed|15699190]
  • view in new tab

    Biological materials

    Mutant

  • BKE05560 ([gene|483587EB658850D786C3C95C02D419994FCC9F45|ydgA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGATATGGCATAGACGAAA, downstream forward: _UP4_AATCAAATTTAAGGAGAATC
  • BKK05560 ([gene|483587EB658850D786C3C95C02D419994FCC9F45|ydgA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGATATGGCATAGACGAAA, downstream forward: _UP4_AATCAAATTTAAGGAGAATC
  • References

  • 15699190,9068633,11150673,21926231