SubtiBank SubtiBank
yxaA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yxaA

putative glycerate kinase
locus
BSU_40040
pI
4.53
mw
39.24 kDa
protein length
382 aa Sequence Blast
gene length
1149 bp Sequence Blast
function
unknown
product
putative glycerate kinase
essential
no
ec
2.7.1.31
synonyms
glxK

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    4,112,073 4,113,221

    The protein

    Catalyzed reaction/ biological activity

  • (R)-glycerate + ATP --> 3-phospho-D-glycerate + ADP + H+ (according to UniProt)
  • Protein family

  • glycerate kinase type-1 family (single member, according to UniProt)
  • Structure

  • [PDB|3CWC] (from Salmonella Typhimurium 58% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|4907D4585491349E2592B0EF9150312A80785EE5|yxaA]-[gene|9A223AE85131511B7EA3A71EA57D87E8B167FA67|yxaB]
    description
    [Pubmed|15805528,10746760]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15805528], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|15805528,18326573], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B680 (yxaA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1679 NBRP B. subtilis, Japan]
  • BKE40040 ([gene|4907D4585491349E2592B0EF9150312A80785EE5|yxaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCAAATCGCCTCTTTCA, downstream forward: _UP4_TAGCCGATGCACATGCCAAT
  • BKK40040 ([gene|4907D4585491349E2592B0EF9150312A80785EE5|yxaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCAAATCGCCTCTTTCA, downstream forward: _UP4_TAGCCGATGCACATGCCAAT
  • References

  • 10746760