SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


6-phosphogluconolactonase, general stress protein
38.26 kDa
protein length
349 aa Sequence Blast
gene length
1050 bp Sequence Blast
pentose phosphate pathway

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|Pentose phosphate pathway]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    1,369,876 1,370,925

    The protein

    Catalyzed reaction/ biological activity

  • 6-phosphogluconolactone - 6-phosphogluconate (pentose phosphate pathway) [Pubmed|22960854]
  • Protein family

  • cycloisomerase 2 family (single member, according to UniProt)
  • Structure

  • [PDB|3HFQ] (from ''Lactobacillus plantarum'', 42% identity)
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|10482513], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|10482513]
  • view in new tab

    Biological materials


  • MGNA-A754 (ykgB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE13010 ([gene|491B5E27EF3190D307EC43C3BB12490728E39333|ykgB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGATTTCCCCCTTAAA, downstream forward: _UP4_TAAACAAATGGAGTGGCTCT
  • BKK13010 ([gene|491B5E27EF3190D307EC43C3BB12490728E39333|ykgB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGATTTCCCCCTTAAA, downstream forward: _UP4_TAAACAAATGGAGTGGCTCT
  • FLAG-tag construct

  • GP1402 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References

  • 10482513,15576773,22960854