SubtiBank SubtiBank
ykgB
The papers of the month are back! Check them out! Link here

ykgB

6-phosphogluconolactonase, general stress protein
locus
BSU13010
pI
5.15
mw
38.26 kDa
protein length
349 aa Sequence Blast
gene length
1047 bp Sequence Blast
function
pentose phosphate pathway
product
6-phosphogluconolactonase
essential
no
ec
3.1.1.31
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.3|Pentose phosphate pathway]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    1,369,876 → 1,370,925

    The protein

    Catalyzed reaction/ biological activity

  • 6-phosphogluconolactone -→ 6-phosphogluconate (pentose phosphate pathway) [Pubmed|22960854]
  • Protein family

  • cycloisomerase 2 family (according to Swiss-Prot)
  • Structure

  • [PDB|3HFQ] (from ''Lactobacillus plantarum'', 42% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|E8ECEFF86ABD1A2BE439F3CAD5A7C5BB58C4BF8E|ykgA]-[gene|491B5E27EF3190D307EC43C3BB12490728E39333|ykgB]
    description
    [Pubmed|10482513]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|10482513], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|10482513]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A754 (ykgB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/754 NBRP B. subtilis, Japan]
  • BKE13010 (Δ[gene|491B5E27EF3190D307EC43C3BB12490728E39333|ykgB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGATTTCCCCCTTAAA, downstream forward: _UP4_TAAACAAATGGAGTGGCTCT
  • BKK13010 (Δ[gene|491B5E27EF3190D307EC43C3BB12490728E39333|ykgB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGATTTCCCCCTTAAA, downstream forward: _UP4_TAAACAAATGGAGTGGCTCT
  • FLAG-tag construct

  • GP1402 (spc, based on [SW|pGP1331]), available in the [SW|Stülke] lab
  • Antibody

  • **
  • References

  • 10482513,15576773,22960854