SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


ribosomal protein
7.58 kDa
protein length
gene length
201 bp Sequence Blast
ribosomal protein L29

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Ribosomal proteins]
  • Gene

    139,924 140,124

    The protein

    Protein family

  • universal [SW|ribosomal protein] uL29 family (single member, according to UniProt)
  • Structure

  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9371452] (two promoters, about 140bp and 200bp upstream of the start codon), in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • strongly repressed in response to glucose starvation in M9 medium [Pubmed|23033921]
  • likely autorepression of operon expression upon binding of excess of one ribosomal protein to the untranslated region of the mRNA [Pubmed|17616982]
  • additional information

  • term-seq has identified a potential novel regulatory RNA element (protein-dependent leader) including an intrinsic transcription terminator upstream of ''rpsJ'' [Pubmed|27120414]
  • view in new tab

    Biological materials


  • BKE01240 ([gene|49B6E673E28CF21DF629B90A6AD453C46822BDB0|rpmC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGCTTTCATTTGATTC, downstream forward: _UP4_TAATCACTGAGGGGAGGTCG
  • BKK01240 ([gene|49B6E673E28CF21DF629B90A6AD453C46822BDB0|rpmC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGCTTTCATTTGATTC, downstream forward: _UP4_TAATCACTGAGGGGAGGTCG
  • References

  • 8635744,19653700,9371452,11948165,23002217,16271892,16091460,25903689