SubtiBank SubtiBank
rpmC
The papers of the month are back! Check them out! Link here

rpmC

ribosomal protein
locus
BSU01240
pI
10.63
mw
7.58 kDa
protein length
gene length
198 bp Sequence Blast
function
translation
product
ribosomal protein L29
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.4|Ribosomal proteins]
  • Gene

    Coordinates
    139,924 → 140,124

    The protein

    Protein family

  • [SW|ribosomal protein] L29P family (according to Swiss-Prot)
  • Structure

  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • Expression and Regulation

    Operons

    genes
    [gene|751D0B909922D4D931FF3B2285CF142D966FCD48|rpsJ]-[gene|FEF94BD8482A41C493A8BEC3278B518E8BB4EDFE|rplC]-[gene|02F0893E814E00187D7B342990838EE5445CA78B|rplD]-[gene|5F3933197343FBBDCBD42B408837F8EEF0A0BEBD|rplW]-[gene|9445AC486A2B0A025030B275C789D227D5694145|rplB]-[gene|5287063586EB218843451386108E45274C7A8D68|rpsS]-[gene|F3DE42C41EF57DC5DFFF0D28129F2CE5DB781D99|rplV]-[gene|E7F4E01A6005C8469EAC64E8DFED96D0F29791A9|rpsC]-[gene|C5CAED1256F082E722EBA0A72647AA043B5681DB|rplP]-[gene|49B6E673E28CF21DF629B90A6AD453C46822BDB0|rpmC]-[gene|657A76B7786DC44861ECAC8FDFC8B4E8B55EF05F|rpsQ]-[gene|2BE91EEB70A1961D3BBE0603648E64E86CD0B708|rplN]-[gene|7E4159B8999B33370B12C18AFE2455507DEF891C|rplX]-[gene|F34C72BF4C3A8FF710D3B65F87324400ECDE3610|rplE]-[gene|0CC562884650F322298BEA28C889E2ABCB01AFDE|rpsN]-[gene|B50A96DCD3E8FB26BBC2819DA11A6E0B040C1C8E|rpsH]-[gene|20485A785D3AF82889F2018D3EA5B5FA33E64E95|rplF]-[gene|B39056862596254F3EC7AB2466B6FB3634621DF0|rplR]-[gene|144D952B05EBBFF41EC92DF906543EA00475FE69|rpsE]-[gene|87741B91E3081B7CC1C8AF275B38A52C066F018C|rpmD]-[gene|BEACD74FE0AE56E8154F3EB8D4247488030BF0D3|rplO]-[gene|5350DC618130E013757EE667B9AFC5F2EC68EC08|secY]-[gene|DD3A39A84E53A9B2ACBDD89DFAE3560E45C08DC1|adk]-[gene|2F2455E189FC61A6B1EC6B66412FC662E44BD3F6|map]-[gene|15EAA4007484D9F82CF4F402FF156165156FDDDE|ybzG]-[gene|BFAF497FB8E871AA84A0864CB08D2059791C7E73|infA]-[gene|F69B475C014087C6DEBE2F50F91862A623D21D1E|rpmJ]-[gene|C8B2EC9E35BDE4FC9B5642B8169F4BD13ACD30AC|rpsM]-[gene|8F83D1839E63016E2FA599A756A161DA5476D4D1|rpsK]-[gene|8B9957188874E9A20D2490730BA216F813D48F36|S56]-[gene|5996A5C25E108A3C4562686BF34A59CB14FD56EB|rpoA]-[gene|0D210B61B8F58DA21D97CFDE441501E31AB50D00|rplQ]
    description
    [Pubmed|9371452]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9371452] (two promoters, about 140bp and 200bp upstream of the start codon), in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • strongly repressed in response to glucose starvation in M9 medium [Pubmed|23033921]
  • likely autorepression of operon expression upon binding of excess of one ribosomal protein to the untranslated region of the mRNA [Pubmed|17616982]
  • additional information

  • term-seq has identified a potential novel regulatory RNA element (protein-dependent leader) including an intrinsic transcription terminator upstream of ''rpsJ'' [Pubmed|27120414]
  • view in new tab

    Biological materials

    Mutant

  • BKE01240 (Δ[gene|49B6E673E28CF21DF629B90A6AD453C46822BDB0|rpmC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGCTTTCATTTGATTC, downstream forward: _UP4_TAATCACTGAGGGGAGGTCG
  • BKK01240 (Δ[gene|49B6E673E28CF21DF629B90A6AD453C46822BDB0|rpmC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGCTTTCATTTGATTC, downstream forward: _UP4_TAATCACTGAGGGGAGGTCG
  • References

  • 8635744,19653700,9371452,11948165,23002217,16271892,16091460,25903689