SubtiBank SubtiBank
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.


ATP-dependent deoxyribonuclease (subunit A), required for efficient survival and replication restart after replication-transcription conflicts
140.85 kDa
protein length
1232 aa Sequence Blast
gene length
3696 bp Sequence Blast
DNA repair/ recombination
ATP-dependent deoxyribonuclease (subunit A))

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • Gene

    1,139,807 → 1,143,505

    Phenotypes of a mutant

  • ''[gene|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO] [gene|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|addA]-[gene|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|addB]'' double mutants are extremely sensitive against DNA damaging agents [Pubmed|26001966]
  • The protein

    Catalyzed reaction/ biological activity

  • the enzyme is functional as a heterodimer of the [protein|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|AddA] and [protein|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|AddB] subunits, that it is a rapid and processive DNA helicase, and that it catalyses DNA unwinding using one single-stranded DNA motor of 3'→5' polarity located in the [protein|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|AddA] subunit [Pubmed|21071401]
  • the [protein|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|AddB] subunit contains a second putative ATP-binding pocket, but this does not contribute to the observed helicase activity and may instead be involved in the recognition of recombination hotspot sequences [Pubmed|21071401]
  • Protein family

  • uvrD-like helicase C-terminal domain (according to Swiss-Prot)
  • Structure

  • [PDB|3U4Q] (the [protein|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|AddA]-[protein|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|AddB]-DNA complex) [Pubmed|22307084]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7746142], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • positive control by [protein|search|ComK] [Pubmed|7746142]
  • view in new tab

    Biological materials


  • GP1106 ([gene|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|addA]-[gene|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|addB], spc), available in [SW|Jörg Stülke]'s lab
  • BKE10630 (Δ[gene|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|addA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCTGTCCATGTGCTGTCTG, downstream forward: _UP4_TAGCGAGATCCATAAGCTCC
  • BKK10630 (Δ[gene|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|addA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCTGTCCATGTGCTGTCTG, downstream forward: _UP4_TAGCGAGATCCATAAGCTCC
  • Labs working on this gene/protein

  • [SW|Mark Dillingham], Bristol, U.K. ([ homepage])
  • References


  • 23202527,20116346,22933559,19542287,25486468
  • Original publications

  • 8387145,15610857,7746142,19129187,15009890,10756102,9781875,16632468,17570399,20350930,21809208,21821766,22307084,24682829,24670664,22383849,21071401,8752329,8752323,25939832,26001966,8510642