SubtiBank SubtiBank
lrpA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

lrpA

transcriptional regulator (Lrp family) involved in repression of [gene|BAE8062DA8538C9C83FFBA9684BECE9613EEFD2F|glyA] transcription and [protein|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|KinB]-dependent [SW|sporulation]
locus
BSU_05050
pI
7.78
mw
15.30 kDa
protein length
136 aa Sequence Blast
gene length
411 bp Sequence Blast
function
repression of [gene|BAE8062DA8538C9C83FFBA9684BECE9613EEFD2F|glyA] transcription and [protein|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|KinB]-dependent [SW|sporulation]
product
transcription regulator (Lrp family)
essential
no
synonyms
yddO

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay]
  • Gene

    Coordinates
    551,519 551,929

    The protein

    Protein family

  • ([SW|Lrp family])
  • [SW|Domains]

  • [SW|HTH asnC-type domain] (aa 2-63) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|49F609C55238C24045CE4A946C417406C8CAAF9D|lrpA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C107 (yddO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2105 NBRP B. subtilis, Japan]
  • BKE05050 ([gene|49F609C55238C24045CE4A946C417406C8CAAF9D|lrpA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTTGTATCCTTTCT, downstream forward: _UP4_TAGTTAACTTTATAAAACGG
  • BKK05050 ([gene|49F609C55238C24045CE4A946C417406C8CAAF9D|lrpA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTTGTATCCTTTCT, downstream forward: _UP4_TAGTTAACTTTATAAAACGG