SubtiBank SubtiBank
lrpA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lrpA

transcriptional regulator (Lrp family) involved in repression of [gene|BAE8062DA8538C9C83FFBA9684BECE9613EEFD2F|glyA] transcription and [protein|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|KinB]-dependent [SW|sporulation]
locus
BSU_05050
pI
7.78
mw
15.30 kDa
protein length
136 aa Sequence Blast
gene length
411 bp Sequence Blast
function
repression of [gene|BAE8062DA8538C9C83FFBA9684BECE9613EEFD2F|glyA] transcription and [protein|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|KinB]-dependent [SW|sporulation]
product
transcription regulator (Lrp family)
essential
no
synonyms
yddO

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay]
  • Gene

    Coordinates
    551,519 551,929

    The protein

    Protein family

  • ([SW|Lrp family])
  • Expression and Regulation

    Operons

    genes
    [gene|49F609C55238C24045CE4A946C417406C8CAAF9D|lrpA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C107 (yddO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2105 NBRP B. subtilis, Japan]
  • BKE05050 ([gene|49F609C55238C24045CE4A946C417406C8CAAF9D|lrpA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTTGTATCCTTTCT, downstream forward: _UP4_TAGTTAACTTTATAAAACGG
  • BKK05050 ([gene|49F609C55238C24045CE4A946C417406C8CAAF9D|lrpA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTTGTATCCTTTCT, downstream forward: _UP4_TAGTTAACTTTATAAAACGG