SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to transcriptional regulator ([SW|MarR family])
15.73 kDa
protein length
139 aa Sequence Blast
gene length
420 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factor/ other/ based on similarity]
  • Gene

    3,853,717 3,854,136

    Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1379177], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|T-box|T-box]: anti-termination, in [regulon|T-box|T-box]
  • regulation

  • induced by threonine limitation ([SW|T-box]) [Pubmed|19258532]
  • the [SW|T-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • MGNA-A517 (ywhA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE37550 ([gene|4A3CA47533B217F595E7B600923DA31228B94DA8|ywhA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAATTTCCCCATTTC, downstream forward: _UP4_TAGGGATAATAAAAGCCGGT
  • BKK37550 ([gene|4A3CA47533B217F595E7B600923DA31228B94DA8|ywhA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAATTTCCCCATTTC, downstream forward: _UP4_TAGGGATAATAAAAGCCGGT
  • References

  • 1379177,19258532