SubtiBank SubtiBank
iolT
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

iolT

major transporter for inositol
locus
BSU_06230
pI
9.57
mw
51.47 kDa
protein length
473 aa Sequence Blast
gene length
1422 bp Sequence Blast
function
myo-inositol uptake
product
major transporter for inositol
essential
no
synonyms
ydjK

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.3|Carbohydrate transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.16|Utilization of inositol]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    676,442 677,863

    The protein

    Catalyzed reaction/ biological activity

  • transport of myo-inositol [Pubmed|20530884]
  • Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Sugar transporter (TC 2.A.1.1) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|4A77316AA94F9C11DB70AB76711AACBD28098AA1|IolT], [protein|770D9A5BEEEABE9C3FC772E74001329206ECFAB3|AraE], [protein|7CE5A42042E5D52768735E795DB805530691D8A6|YwtG], [protein|8B0701B5694ABA8142476CB896E590FE1981D7DB|YfiG], [protein|A84AC4E40E7C722E27AE9C24ACECFEABD51B57BE|YncC], [protein|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|CsbC], [protein|4A77316AA94F9C11DB70AB76711AACBD28098AA1|IolT]
  • Structure

  • [PDB|4LDS] (glucose transporter from Staphylococcus epidermidis, 36% identity) [pubmed|24127585]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|4A77316AA94F9C11DB70AB76711AACBD28098AA1|iolT]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR]: repression, [pubmed|11807058], in [regulon|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR regulon]
  • regulation

  • induced in the presence of inositol ([protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR]) [Pubmed|11807058]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C218 (ydjK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2216 NBRP B. subtilis, Japan]
  • BKE06230 ([gene|4A77316AA94F9C11DB70AB76711AACBD28098AA1|iolT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTGTTTCCCCCAGTCT, downstream forward: _UP4_TAATTTAAAAAAGAATCCGC
  • BKK06230 ([gene|4A77316AA94F9C11DB70AB76711AACBD28098AA1|iolT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTGTTTCCCCCAGTCT, downstream forward: _UP4_TAATTTAAAAAAGAATCCGC
  • References

  • 11807058,20530884,28431560,24127585