SubtiBank SubtiBank
thrC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

thrC

threonine synthase, has a minor threonine dehydratase ([protein|D0CF32BF81AA1DC7BBBC3E9B667A54F97260DF3F|IlvA]) activity
locus
BSU_32250
pI
5.18
mw
37.31 kDa
protein length
352 aa Sequence Blast
gene length
1059 bp Sequence Blast
function
biosynthesis of threonine
product
threonine synthase
essential
no
ec
4.2.3.1
synonyms
thrB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.6|Biosynthesis/ acquisition of lysine/ threonine]
  • Gene

    Coordinates
    3,313,770 3,314,828

    The protein

    Catalyzed reaction/ biological activity

  • O-phospho-L-homoserine + H2O --> L-threonine + phosphate (according to UniProt)
  • has additional threonine dehydratase activity [pubmed|27260660]
  • Protein family

  • threonine synthase family (single member, according to UniProt)
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|6CGQ] (complexed with PLP and PLP-Ala) [pubmed|30830751]
  • [PDB|6NMX] (complexed with PLP and (Z)-L-2-amino-5-phosphono-3-pentenoic acid (APPA)) [Pubmed|30830751]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|0F40291BB10DB6D7DFD94B9C7D700F4410C4EE69|yutH]-[gene|11421D5BD3AB6C205DDA0864F878E2B04340033F|hom]-[gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]-[gene|290302BA8A4E44C62AE3071C1F7DE18B20605607|thrB]
    description
    [Pubmed|22383849]

    regulation

  • expressed during [SW|sporulation] [Pubmed|22383849]
  • view in new tab

    genes
    [gene|11421D5BD3AB6C205DDA0864F878E2B04340033F|hom]-[gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]-[gene|290302BA8A4E44C62AE3071C1F7DE18B20605607|thrB]
    description
    [Pubmed|12107147]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|24163341], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|25755103], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|A4B7CF7A1C704C750AFAD97A43AF975260935083|ThrR]: repression, [Pubmed|27260660], in [regulon|A4B7CF7A1C704C750AFAD97A43AF975260935083|ThrR regulon]
  • regulation

  • expressed in the presence of lysine or cysteine ([SW|ThrR]) [Pubmed|27260660]
  • view in new tab

    Biological materials

    Mutant

  • GP3030 Δ''[gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]''::''spec'', available in [SW|Jörg Stülke]'s lab
  • 1A773 (''thrC''::''cat''), [Pubmed|8973347], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A773&Search=1A773 BGSC] and in [SW|Jörg Stülke]'s lab
  • BKE32250 ([gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGATGGATAAGTCCTTTCC, downstream forward: _UP4_TATGTAAAAGGAGCGGCCCG
  • BKK32250 ([gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGATGGATAAGTCCTTTCC, downstream forward: _UP4_TATGTAAAAGGAGCGGCCCG
  • References

  • 12107147,3098560,24163341,15378759,27260660,30830751,4630852,4199513