SubtiBank SubtiBank
yosR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yosR

glutaredoxin-like thioredoxin
locus
BSU_20030
pI
4.38
mw
8.95 kDa
protein length
gene length
243 bp Sequence Blast
function
unknown
product
thioredoxin
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,159,742 2,159,984

    The protein

    Protein family

  • [SW|Thioredoxin family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|4E5C84FDC8FE2FEFF47306C91ECAB7F17D3E38E9|TrxA]
  • Structure

  • [PDB|4BA7] (ancestral thioredoxin relative to Last Bacteria Common Ancestor (LBCA) from the precambrian period) (36% identity), [Pubmed|23932589]
  • Biological materials

    Mutant

  • BKE20030 ([gene|4A8B6D88FEA9D18E1BAE08847A5F7683F9D6CDF4|yosR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGCTGCTCTAATTTAATTA, downstream forward: _UP4_TAAAAGGGTAATTTTAAACA
  • BKK20030 ([gene|4A8B6D88FEA9D18E1BAE08847A5F7683F9D6CDF4|yosR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGCTGCTCTAATTTAATTA, downstream forward: _UP4_TAAAAGGGTAATTTTAAACA
  • References

  • 24401092,23932589