SubtiBank SubtiBank
ydiG
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydiG

molybdenum cofactor biosynthesis protein
locus
BSU_05960
pI
6.22
mw
18.31 kDa
protein length
170 aa Sequence Blast
gene length
513 bp Sequence Blast
function
unknown
product
molybdenum cofactor biosynthesis protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.10|Biosynthesis of molybdopterin]
  • Gene

    Coordinates
    646,582 647,094

    The protein

    Catalyzed reaction/ biological activity

  • involved in the first step of molybdenum cofactor biosynthesis (together with [protein|19EB8E7CBC0E8D7A6429ADFFF93D1F71EFE3FF11|MoaA])
  • (8S)-3',8-cyclo-7,8-dihydroguanosine 5'-triphosphate --> cyclic pyranopterin phosphate + diphosphate (according to UniProt)
  • Protein family

  • moaC family (single member, according to UniProt)
  • Structure

  • [PDB|1EKR] (the protein from ''E. coli'', 51% identity, 78% similarity) [Pubmed|10903949]
  • Expression and Regulation

    Operons

    genes
    [gene|4A8D74B83E20FA138ED66F0D8FD456B69B740D92|ydiG]-[gene|B5EF521437323EF43F08E5EFDB5C798616CA499A|rex]-[gene|780FDF3DD260287428B397FFE7F44DDF1917381C|tatAY]-[gene|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|tatCY]
    description
    [Pubmed|22383849]

    regulation

  • constitutitvely expressed [Pubmed|22383849]
  • the mRNA is processed between [gene|B5EF521437323EF43F08E5EFDB5C798616CA499A|rex] and [gene|780FDF3DD260287428B397FFE7F44DDF1917381C|tatAY] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C200 (ydiG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2198 NBRP B. subtilis, Japan]
  • BKE05960 ([gene|4A8D74B83E20FA138ED66F0D8FD456B69B740D92|ydiG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTAAAACGCTCCTTAA, downstream forward: _UP4_GAGTATAATTTGGAGGACCA
  • BKK05960 ([gene|4A8D74B83E20FA138ED66F0D8FD456B69B740D92|ydiG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTAAAACGCTCCTTAA, downstream forward: _UP4_GAGTATAATTTGGAGGACCA
  • References

    Reviews

  • 23539623
  • Original publications

  • 10903949,22383849