SubtiBank SubtiBank
purF

purF

glutamine phosphoribosyldiphosphate amidotransferase
locus
BSU_06490
pI
5.87
mw
51.45 kDa
protein length
476 aa Sequence Blast
gene length
1431 bp Sequence Blast
function
purine biosynthesis
product
glutamine phosphoribosyldiphosphate amidotransferase
essential
no
ec
2.4.2.14
synonyms
purB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.1|Biosynthesis/ acquisition of purine nucleotides]
  • Gene

    Coordinates
    705,441 706,871

    The protein

    Catalyzed reaction/ biological activity

  • 5-phospho-β-D-ribosylamine + diphosphate + L-glutamate --> 5-phospho-α-D-ribose 1-diphosphate + H2O + L-glutamine (according to UniProt)
  • Protein family

  • [SW|Purine/pyrimidine phosphoribosyltransferase family] (according to UniProt)
  • [SW|Domains]

  • [SW|Glutamine amidotransferase type-2 domain] (aa 12-231) (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|1GPH], [PDB|1AO0] (complex with ADP and GMP)
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
  • Expression and Regulation

    Operons

    genes
    [gene|1A9F7847AA1EB2A264842B44CD1B1A21F0AF6E57|purE]-[gene|0DA73E4D1935F6A91BE251EF2704A11DE5D81174|purK]-[gene|29FF54E2B9F4A11811F5E15885A4C02A259C7B35|purB]-[gene|447D12E940C7F45B6C5015844F9DED9D513CD6E5|purC]-[gene|CCD4DA969086181CFA33D6D241F2CAAE02E0C758|purS]-[gene|DEE856E83E790EB57F103F7A9156408AF090995D|purQ]-[gene|D34203FAA84C19B34B3CB5F00AC2E2663FFA344D|purL]-[gene|4AA5AF9C7CE8D0A9FD3A47650ECF130BCBEE1952|purF]-[gene|AD0DE9457D70DF02FA0F58867B24ABF236FAF65A|purM]-[gene|7B30F27D6C459437967A64467E52961F4A9E0F2C|purN]-[gene|54CE8EB2F5D1F9AEAA497E1F60248C9B2250B01E|purH]-[gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]
    description
    [Pubmed|3036807]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3036807], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, ([SW|riboswitch]) [pubmed|3036807,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • expression activated by glucose (4.4 fold) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • BKE06490 ([gene|4AA5AF9C7CE8D0A9FD3A47650ECF130BCBEE1952|purF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCAAAAACGCCGCATTCTT, downstream forward: _UP4_TAAAACTTGAAAAATGACAT
  • BKK06490 ([gene|4AA5AF9C7CE8D0A9FD3A47650ECF130BCBEE1952|purF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCAAAAACGCCGCATTCTT, downstream forward: _UP4_TAAAACTTGAAAAATGACAT
  • References

    Reviews

  • 12859215,11395405
  • Original publications

  • 6315725,12923093,6794614,2553706,6401710,6771260,2495277,109433,6814966,6411716,6411717,6794613,3036807,8197456,7638212,25023436