SubtiBank SubtiBank
yrvC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yrvC

unknown
locus
BSU_27640
pI
4.87
mw
18.20 kDa
protein length
165 aa Sequence Blast
gene length
498 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,826,245 2,826,742

    The protein

    [SW|Domains]

  • contains a [SW|RCK_C domain] (aa 76-161) at the C-terminus (according to [http://www.uniprot.org/uniprot/?query=RCK+C-terminal+domain&sort=score UniProt])
  • Expression and Regulation

    Operons

    genes
    [gene|4AF865F1E16187F89C1FE19BAE5C2CF2C0A53E4A|yrvC]-[gene|418A95E9DD8DE2690C1E65E2A4198E5C5AC6E6D3|yrvD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B518 (yrvC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1517 NBRP B. subtilis, Japan]
  • GP2099 ([gene|4AF865F1E16187F89C1FE19BAE5C2CF2C0A53E4A|yrvC]-[gene|418A95E9DD8DE2690C1E65E2A4198E5C5AC6E6D3|yrvD]::''zeo''), available in [SW|Jörg Stülke]'s lab
  • BKE27640 ([gene|4AF865F1E16187F89C1FE19BAE5C2CF2C0A53E4A|yrvC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATAAACCCTCCTACA, downstream forward: _UP4_TAACCTAGTGTTAAGCCATG
  • BKK27640 ([gene|4AF865F1E16187F89C1FE19BAE5C2CF2C0A53E4A|yrvC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATAAACCCTCCTACA, downstream forward: _UP4_TAACCTAGTGTTAAGCCATG
  • GP2713 ([gene|4AF865F1E16187F89C1FE19BAE5C2CF2C0A53E4A|yrvC]-[gene|418A95E9DD8DE2690C1E65E2A4198E5C5AC6E6D3|yrvD]::''cat''), available in [SW|Jörg Stülke]'s lab
  • Expression vectors

  • pGP2908 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 31361596