SubtiBank SubtiBank
yhfN
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yhfN

similar to metalloprotease
locus
BSU_10290
pI
6.08
mw
48.71 kDa
protein length
426 aa Sequence Blast
gene length
1281 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yzoA

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    1,103,104 1,104,384

    The protein

    Protein family

  • Peptidase M48B family (with [protein|62B6875301B458F04E3F65717AD3A5925A9C4973|HtpX], according to UniProt)
  • Structure

  • [PDB|4AW6] (human protein, 24% identity) [pubmed|23539603]
  • Expression and Regulation

    Operons

    genes
    [gene|4B54FF77FD5B6E22D6EF3DBECD9B84C0B5A60E18|yhfN]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A713 (yhfN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/713 NBRP B. subtilis, Japan]
  • BKE10290 ([gene|4B54FF77FD5B6E22D6EF3DBECD9B84C0B5A60E18|yhfN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGCCTCACTCCTCAC, downstream forward: _UP4_TAAAAAGAAGCAGGTATGGA
  • BKK10290 ([gene|4B54FF77FD5B6E22D6EF3DBECD9B84C0B5A60E18|yhfN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGCCTCACTCCTCAC, downstream forward: _UP4_TAAAAAGAAGCAGGTATGGA
  • References

  • 9015299,23539603