SubtiBank SubtiBank
yrhJ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yrhJ

cytochrome P450 (CYP102A3)/ NADPH-cytochrome P450 reductase
locus
BSU_27160
pI
6.02
mw
118.47 kDa
protein length
1054 aa Sequence Blast
gene length
3165 bp Sequence Blast
function
fatty acid metabolism
product
NADPH-cytochrome P450 reductase
essential
no
ec
1.6.2.4
synonyms
cypB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.3|Lipid metabolism/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    2,773,890 2,777,054

    The protein

    Catalyzed reaction/ biological activity

  • hydroxylates medium-chain fatty acids in subterminal positions [Pubmed|14741768]
  • organic molecule + O2 + reduced [NADPH—hemoprotein reductase] --> alcohol + H+ + H2O + oxidized [NADPH—hemoprotein reductase] (according to UniProt)
  • NADPH + 2 oxidized [cytochrome P450] --> H+ + NADP+ + 2 reduced [cytochrome P450] (according to UniProt)
  • Protein family

  • N-terminal part: [SW|cytochrome P450] family (according to UniProt)
  • Paralogous protein(s)

  • [protein|9AA8CAEB42B1ED4CC8D80D57B045A55307114D6A|YetO]
  • [SW|Domains]

  • [SW|Flavodoxin-like domain] (aa 486-625) (according to UniProt)
  • [SW|FAD-binding FR-type domain] (aa 663-896) (according to UniProt)
  • Structure

  • [PDB|2X7Y] (from Bacillus megaterium; 67% identity, 88% similarity) [Pubmed|25325618,22949185]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]-[gene|4BA5214C441C6671CB7DAA3CACBCA5FC025BE0E6|yrhJ]
    description
    [Pubmed|10917605]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421,12775685], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|9636707], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulatory mechanism

  • [protein|3DA3FFB295F5513A220CB163994EE0F356C810E6|FatR]: repression, [Pubmed|11734890], in [regulon|3DA3FFB295F5513A220CB163994EE0F356C810E6|FatR regulon]
  • regulation

  • expression is reduced in a [protein|search|SigV] mutant [Pubmed|21926231]
  • additional information

  • A [protein|search|ncRNA] ([SW|RnaC]) is encoded between '[protein|search|yrhK]' and '[protein|search|yrhJ]' [PubMed|25790031]
  • view in new tab

    genes
    [gene|6D5089931FBDB398A7FAF3C8DDF341EB4949AEFE|yrhH]-[gene|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]-[gene|4BA5214C441C6671CB7DAA3CACBCA5FC025BE0E6|yrhJ]
    description
    [Pubmed|18179421]

    regulation

  • Expressed under stress conditions ([protein|search|SigW], [protein|search|SigX]) [Pubmed|9683469]
  • additional information

  • A [protein|search|ncRNA] ([SW|RnaC]) is encoded between '[protein|search|yrhK]' and '[protein|search|yrhJ]' [PubMed|25790031]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A163 (yrhJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/163 NBRP B. subtilis, Japan]
  • BKE27160 ([gene|4BA5214C441C6671CB7DAA3CACBCA5FC025BE0E6|yrhJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGTTTCATTAACATCTCCC, downstream forward: _UP4_TAAAATATAAAATCCCGCCA
  • BKK27160 ([gene|4BA5214C441C6671CB7DAA3CACBCA5FC025BE0E6|yrhJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGTTTCATTAACATCTCCC, downstream forward: _UP4_TAAAATATAAAATCCCGCCA
  • References

  • 11734890,10917605,11574077,14741768,15122913,12775685,16716428,16381045,20525796,12207695,9636707,21926231,25325618,22949185,25790031