SubtiBank SubtiBank
pucG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pucG

(S)-ureidoglycine-glyoxylate aminotransferase
locus
BSU_32520
pI
5.42
mw
45.58 kDa
protein length
416 aa Sequence Blast
gene length
1251 bp Sequence Blast
function
purine utilization
product
(S)-ureidoglycine-glyoxylate aminotransferase
essential
no
synonyms
yurG

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • Gene

    Coordinates
    3,341,166 3,342,416

    The protein

    Catalyzed reaction/ biological activity

  • transamination between an unstable intermediate ((S)-ureidoglycine) and the end product of purine catabolism (glyoxylate) to yield oxalurate and glycine [Pubmed|20852637]
  • (S)-2-ureidoglycine + glyoxylate --> glycine + N-carbamoyl-2-oxoglycine (according to UniProt)
  • Protein family

  • [SW|Class-V pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|3ISL] [Pubmed|20852637]
  • Expression and Regulation

    Operons

    genes
    [gene|C314CE9D194E8894430368C5F69C0778D45A651C|pucF]-[gene|4BC4B3E0AB4779D1DD5EDF591361FC1094AF661F|pucG]
    description
    [Pubmed|12029039]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12029039], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • regulation

  • induced in the presence of purine nucleotides (inducer: allantoin) ([protein|search|PucR]) [Pubmed|12029039]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A942 (yurG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/942 NBRP B. subtilis, Japan]
  • BKE32520 ([gene|4BC4B3E0AB4779D1DD5EDF591361FC1094AF661F|pucG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCCTGACACAGCCATTCCTC, downstream forward: _UP4_TAAAGAAAAGCTTGCGGAAC
  • BKK32520 ([gene|4BC4B3E0AB4779D1DD5EDF591361FC1094AF661F|pucG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCCTGACACAGCCATTCCTC, downstream forward: _UP4_TAAAGAAAAGCTTGCGGAAC
  • References

  • 11344136,20852637,12029039