SubtiBank SubtiBank
ydcQ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ydcQ

coupling protein, part of the type IV secretion system for DNA transfer
locus
BSU_04860
pI
9.28
mw
54.57 kDa
protein length
480 aa Sequence Blast
gene length
1443 bp Sequence Blast
function
conjugative transfer of ICEBs1
product
coupling protein, part of the type IV secretion system for DNA transfer
essential
no
synonyms
conQ

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.2|Mobile genetic elements] → [category|SW 5.2.1|ICEBs1]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    533,338 534,780

    The protein

    [SW|Domains]

  • [SW|FtsK domain] (aa 217-399) (according to UniProt)
  • Structure

  • [PDB|6O1X] (from Clostridium perfringens, corresponds to aa 219 ... 396, 27% identity)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|EE2A4068CBD7A2F852E582E2EDA4148381F1CD61|xis]-[gene|2227923C603B290AB276238F789D71584FB07DF3|ydzL]-[gene|34451538F10B4ABCFC8A236C8C905A20D989EBCF|ydcO]-[gene|C042792D9A643DCFF4A851EFECA3CF2C31E1EDAF|ydcP]-[gene|4BCAA5939CB7F0DF23495BC92C9EF0A0149296A0|ydcQ]-[gene|8E179976C35FE09F92A191D00E497ED4BF28F571|nicK]-[gene|886B2132717BA4C72433ABE351C5791C9DE1432A|S172]-[gene|1699CFBF5400CAF43C6DAE8ADCCE5A360B31F2E9|ydcS]-[gene|9D4918852A1856B1CDD72D49AEA75E51A8602BB6|ydcT]-[gene|62CEABA069CA2970F22B7E0C369D540A2A027A8D|yddA]-[gene|A0AFD543582D2FE8B1139CF69B7B1F7FF0F80265|conB]-[gene|F273A8817E66B44D58FC2BCB6576A30D8616B750|conC]-[gene|F1F898D7A9FDF78D2E5E8F3BF605E0F735D0542A|conD]-[gene|D20F724D8C3E8C758A9FADF133CD43F066BD8D48|conE]-[gene|B3A07E2A61151C33B7C65D1BC58B97BFDB76852D|yddF]-[gene|3356A43B83E2D4D66098F17A751F0912C1553398|conG]-[gene|8D9D81E05BAA8697F002BB1B8DBC5ABBA557353F|cwlT]-[gene|2E4FF80C857B3F40BA835814EC40D6562721AEFE|yddI]-[gene|2FB1C9435AE924F8E450AFA81F800196A871F2D0|yddJ]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR]: repression, [Pubmed|17511812], in [regulon|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR regulon]
  • regulation

  • strongly induced in the presence of salt (1.2 M NaCl) [pubmed|32419322]
  • view in new tab

    Biological materials

    Mutant

  • BKE04860 ([gene|4BCAA5939CB7F0DF23495BC92C9EF0A0149296A0|ydcQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATACATCACCCGCCTGC, downstream forward: _UP4_AGCGGCGAAGGAGTGAGCGA
  • BKK04860 ([gene|4BCAA5939CB7F0DF23495BC92C9EF0A0149296A0|ydcQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATACATCACCCGCCTGC, downstream forward: _UP4_AGCGGCGAAGGAGTGAGCGA
  • References

  • 23326247,26013486