SubtiBank SubtiBank
ydiR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydiR

component of the BsuM DNA restriction system
locus
BSU_06090
pI
4.39
mw
35.16 kDa
protein length
313 aa Sequence Blast
gene length
942 bp Sequence Blast
function
BsuM DNA restriction
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.4|DNA restriction/ modification]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.5|Prophage 3]
  • Gene

    Coordinates
    659,623 660,564

    The protein

    Catalyzed reaction/ biological activity

  • Endonucleolytic cleavage of DNA to give specific double-stranded fragments with terminal 5'-phosphates (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|4BD4CFB10700907DF1BBF3C9CFACAF573588E85F|ydiR]-[gene|A8C606348C8C6FC3BB9786C06C9BFE9D3519A041|ydiS]-[gene|D36B91B3C8EAFEB80A7395C62A50A5F80B8CC5C5|ydjA]
    description
    [Pubmed|11751814]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C207 (ydiR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2205 NBRP B. subtilis, Japan]
  • BKE06090 ([gene|4BD4CFB10700907DF1BBF3C9CFACAF573588E85F|ydiR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATTTTACCCCCATAA, downstream forward: _UP4_TAAGCGATAAACTTTAAATA
  • BKK06090 ([gene|4BD4CFB10700907DF1BBF3C9CFACAF573588E85F|ydiR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATTTTACCCCCATAA, downstream forward: _UP4_TAAGCGATAAACTTTAAATA
  • References

  • 11751814,22092861