SubtiBank SubtiBank
dgcP
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

dgcP

diguanylate cyclase
locus
BSU_29650
pI
5.70
mw
65.30 kDa
protein length
579 aa Sequence Blast
gene length
1740 bp Sequence Blast
function
synthesis of c-di-GMP
product
diguanylate cyclase
essential
no
synonyms
ytrP

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • Gene

    Coordinates
    3,033,696 3,035,435

    The protein

    Catalyzed reaction/ biological activity

  • synthesis of c-di-GMP from two molecules of GTP [Pubmed|23893111]
  • [SW|Domains]

  • contains an N-terminal GAF domain [Pubmed|23893111]
  • contains a C-terminal [SW|GGDEF domain] [Pubmed|22821967]
  • [SW|Localization]

  • cytoplasma, forms subcellular clusters at the periphery of exponentially growing cells [pubmed|28536559]
  • additional information

  • DgcP is present with about 25 molecules per cell [pubmed|32156823]
  • Expression and Regulation

    Operons

    genes
    [gene|4C577B2CEDD9CD2CBFAF036EF36C9EFAF16F923F|dgcP]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A425 (ytrP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/425 NBRP B. subtilis, Japan]
  • GP1591 (tet) available in [SW|Jörg Stülke]'s lab
  • BKE29650 ([gene|4C577B2CEDD9CD2CBFAF036EF36C9EFAF16F923F|dgcP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTTATCACCTAAAA, downstream forward: _UP4_TAAAAAAAGCCCAAAACGAT
  • BKK29650 ([gene|4C577B2CEDD9CD2CBFAF036EF36C9EFAF16F923F|dgcP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTTATCACCTAAAA, downstream forward: _UP4_TAAAAAAAGCCCAAAACGAT
  • References

  • 23893111,22821967,28536559,32156823