SubtiBank SubtiBank
nrnA

nrnA

oligoribonuclease (nanoRNase), 3,5-bisphosphate nucleotidase, degradation of pGpG
locus
BSU_29250
pI
4.67
mw
34.93 kDa
protein length
313 aa Sequence Blast
gene length
942 bp Sequence Blast
function
degradation of RNA oligonucleotides
product
oligoribonuclease (nanoRNase), 3,5-bisphosphate nucleotidase
essential
no
ec
3.1.3.7
synonyms
ytqI

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW 3.2.4.1|Exoribonucleases]
  • Gene

    Coordinates
    2,995,908 2,996,849

    Phenotypes of a mutant

  • The mutant requires cysteine [Pubmed|17586819]
  • inactivation of ''[gene|4C630B61249F8F2369E9BFE8A49885D3225DE7B6|nrnA]'' reduces sporulation efficiency to 5% that of wild type cells; delayed entry into sporulation, reduced SigmaG activity, and production of small forespores [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • oligoribonuclease (nanoRNAse), 3',5'-bisphosphate nucleotidase [Pubmed|17586819]
  • hydrolyzes oligo(deoxy)ribonucleotides in a 5' 3' direction [Pubmed|28894100,21087930]
  • hydrolyzes nano-RNAs in a 3' 5' direction [Pubmed|28894100]
  • degradation of pGpG derived from c-di-GMP [pubmed|30249708]
  • adenosine 3',5'-bisphosphate + H2O --> AMP + phosphate (according to UniProt)
  • Protein family

  • NrnA oligoribonuclease family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|DHH-DHHA1 domain] [pubmed|28894100]
  • [SW|Cofactors]

  • Mn2+ [pubmed|28894100]
  • Structure

  • [PDB|5J21] [pubmed|28894100]
  • [SW|Localization]

  • Cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|4C630B61249F8F2369E9BFE8A49885D3225DE7B6|nrnA]
    description
    [Pubmed|9387221]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A151 (ytqI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/151 NBRP B. subtilis, Japan]
  • GP2155 (''[gene|4C630B61249F8F2369E9BFE8A49885D3225DE7B6|nrnA]''::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • BKE29250 ([gene|4C630B61249F8F2369E9BFE8A49885D3225DE7B6|nrnA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGATACTCCTTTATTG, downstream forward: _UP4_GAGTAGAGGGGAGACCCTCT
  • BKK29250 ([gene|4C630B61249F8F2369E9BFE8A49885D3225DE7B6|nrnA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGATACTCCTTTATTG, downstream forward: _UP4_GAGTAGAGGGGAGACCCTCT
  • References

    Reviews

  • 29458847,31464530
  • Original publications

  • 17586819,9387221,16479537,19429620,19553197,21087930,22102036,26691161,21768284,24013631,26735940,27834680,28894100,30249708