SubtiBank SubtiBank
trpD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

trpD

anthranilate phosphoribosyltransferase
locus
BSU_22670
pI
4.90
mw
35.87 kDa
protein length
338 aa Sequence Blast
gene length
1017 bp Sequence Blast
function
biosynthesis of tryptophan
product
anthranilate phosphoribosyltransferase
essential
no
ec
2.4.2.18
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.13|Biosynthesis/ acquisition of aromatic amino acids]
  • Gene

    Coordinates
    2,374,881 2,375,897

    The protein

    Catalyzed reaction/ biological activity

  • diphosphate + N-(5-phospho-β-D-ribosyl)anthranilate --> 5-phospho-α-D-ribose 1-diphosphate + anthranilate (according to UniProt)
  • Protein family

  • anthranilate phosphoribosyltransferase family (single member, according to UniProt)
  • Structure

  • [PDB|4YI7] (from Acinetobacter sp., 42% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: termination/antitermination, [pubmed|1551827], in [regulon|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB regulon]
  • regulation

  • not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|1551827]
  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • the [SW|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    genes
    [gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]-[gene|4D7D62B4CDA350DCDC04E6934B5E23ECE4C57870|hisC]-[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]-[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: termination/antitermination, [pubmed|1551827], in [regulon|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB regulon]
  • regulation

  • not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|1551827]
  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • BKE22670 ([gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCACCGGCAGTAAGGGTTT, downstream forward: _UP4_CTAAAGCAGAAAGAGGAAGA
  • BKK22670 ([gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCACCGGCAGTAAGGGTTT, downstream forward: _UP4_CTAAAGCAGAAAGAGGAAGA
  • References

    Reviews

  • 12966138
  • Original publications

  • 14976255,3924737,6436812,2422155,8419914,1551827,21815947