SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


membrane-bound chemotaxis receptor, methyl-accepting chemotaxis protein, acts also as pH sensor, responds to increasing pH as an attractant signal
71.36 kDa
protein length
662 aa Sequence Blast
gene length
1989 bp Sequence Blast
control of chemotaxis, sensing of alkaline environments
methyl-accepting chemotaxis protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Signal transduction in motility and chemotaxis] → [category|SW|Membrane-bound chemoreceptors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,204,067 3,206,055

    The protein

    Paralogous protein(s)

  • [protein|8333CD46F704F03A22482CAA98DEFCC945362A10|McpC], [protein|E4E1020B799A1B403BDB4847B91B02D64D161AF3|McpB], [protein|F02E3080214A327E131ECDE0DBC52C57EFDFE2CE|McpA], [protein|1DE26CDEE952142C1303C822F0E2A63AE09F721B|TlpA]
  • [SW|Domains]

  • [SW|Cache domain] (aa 153-228) (according to UniProt)
  • [SW|HAMP domain] (aa 203-355) (according to UniProt)
  • [SW|Methyl-accepting transducer domain] (aa 374-610) (according to UniProt)
  • Structure

  • [PDB|6S1K] (from E. coli, corresponds to aa 285 ... 616, 29% identity) [pubmed|31925330]
  • [SW|Localization]

  • cell membrane [Pubmed|21515776]
  • Expression and Regulation



    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8188684], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • additional information

  • in minimal medium, TlpB is present with 2,500 +/- 740 molecules per cell [PubMed|21515776]
  • view in new tab

    Biological materials


  • BKE31230 ([gene|4CD44AD8FE68516C84889EAA2137828E06B8A30B|tlpB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCGTTGACTCCTCCT, downstream forward: _UP4_TAATGAAACGAGAAAGCGGC
  • BKK31230 ([gene|4CD44AD8FE68516C84889EAA2137828E06B8A30B|tlpB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCGTTGACTCCTCCT, downstream forward: _UP4_TAATGAAACGAGAAAGCGGC
  • References


  • 31792011
  • Original publications

  • 8188684,21515776,31685537