The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

bkdR

transcriptional activator of the [gene|1CFF7202AC6078B6BAD1253F77FD4FE227C046DB|ptb]-[gene|A52E50104B18D0A8518218C52D9CC36FDDB29AAF|bcd]-[gene|8E08A0333E4EC89003DA3C1DD8DCD39CDDC8624C|buk]-[gene|1FD06CB6E81C920EFC656DBE2A13D68B1AA68872|lpdV]-[gene|9F298088C0A9EB7FE140C935AFC9243C6D4DE8AE|bkdAA]-[gene|A024921961A786294199EA12E04456C890ED8D8C|bkdAB]-[gene|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|bkdB] operon

locus: BSU_24100

pI: 6.24

mw: 77.75 kDa

protein length: 692 aa

gene length: 2079 bp

function: regulation of branched-chain amino acid utilization

product: transcriptional activator (for [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]-dependent promoter)

essential: no

synonyms: yqiR

Genomic Context

categories

• [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.9|Utilization of branched-chain amino acids]
• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]

Gene

Coordinates: 2,504,789 2,506,867

Phenotypes of a mutant

• cold-sensitive [pubmed|16585774]

The protein

Protein family

• [SW|Transcription factors activating transcription at SigL-dependent promoters]

[SW|Domains]

• 2 [SW|PAS domain]s (aa 115-185, aa 234-305) (according to UniProt)
• [SW|Sigma-54 factor interaction domain] (aa 368-598) (according to UniProt)

Structure

• [PDB|1OJL] (ZraR from Salmonella typhimurium, C-terminal interaction domain, corresponds to aa 368 ... 683 of BkdR, 41% identity) [pubmed|16005641]

Expression and Regulation

Operons

• genes: [gene|4CEBD81F485DD0B660E297FFC34A0F5270652184|bkdR]
  description: [Pubmed|12823818]

  regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|10094682], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]

  regulation

  • repressed during growth in the presence of branched chain amino acids ([protein|search|CodY]) [Pubmed|10094682]

Biological materials

Mutant

• MGNA-C375 (yqiR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2373 NBRP B. subtilis, Japan]
• 1A913 ( ''bkdR''::''kan''), [Pubmed|16585774], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A913&Search=1A913 BGSC] and in [SW|Jörg Stülke]'s lab
• BKE24100 ([gene|4CEBD81F485DD0B660E297FFC34A0F5270652184|bkdR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCGATACCCCTTTGTA, downstream forward: _UP4_TAATTTGCAGAATAAACGCA
• BKK24100 ([gene|4CEBD81F485DD0B660E297FFC34A0F5270652184|bkdR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCGATACCCCTTTGTA, downstream forward: _UP4_TAATTTGCAGAATAAACGCA

References

• 16585774,10094682,23123912,12823818,21906631,16005641