SubtiBank SubtiBank
yvaV
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yvaV

unknown, similar to transcription factor [protein|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|OpcR]
locus
BSU_33740
pI
4.99
mw
21.12 kDa
protein length
177 aa Sequence Blast
gene length
534 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    3,463,534 3,464,067

    The protein

    Protein family

  • GbsR family (with [protein|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|GbsR] and [protein|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|OpcR], according to UniProt)
  • Paralogous protein(s)

  • [protein|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|OpcR]
  • Expression and Regulation

    Operons

    genes
    [gene|4D288C63F68A9A4B39535D849D455B49F4E65050|yvaV]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A448 (yvaV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/448 NBRP B. subtilis, Japan]
  • BKE33740 ([gene|4D288C63F68A9A4B39535D849D455B49F4E65050|yvaV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGGTTTCATCCTTTCAG, downstream forward: _UP4_TAAAAAGTTCCCAAATTCAA
  • BKK33740 ([gene|4D288C63F68A9A4B39535D849D455B49F4E65050|yvaV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGGTTTCATCCTTTCAG, downstream forward: _UP4_TAAAAAGTTCCCAAATTCAA
  • References

  • 23960087