SubtiBank SubtiBank
yvaV
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvaV

unknown, similar to transcription factor [protein|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|OpcR]
locus
BSU_33740
pI
4.99
mw
21.12 kDa
protein length
177 aa Sequence Blast
gene length
534 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    3,463,534 3,464,067

    The protein

    Protein family

  • GbsR family (with [protein|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|GbsR] and [protein|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|OpcR], according to UniProt)
  • Paralogous protein(s)

  • [protein|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|OpcR]
  • Expression and Regulation

    Operons

    genes
    [gene|4D288C63F68A9A4B39535D849D455B49F4E65050|yvaV]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A448 (yvaV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/448 NBRP B. subtilis, Japan]
  • BKE33740 ([gene|4D288C63F68A9A4B39535D849D455B49F4E65050|yvaV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGGTTTCATCCTTTCAG, downstream forward: _UP4_TAAAAAGTTCCCAAATTCAA
  • BKK33740 ([gene|4D288C63F68A9A4B39535D849D455B49F4E65050|yvaV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGGTTTCATCCTTTCAG, downstream forward: _UP4_TAAAAAGTTCCCAAATTCAA
  • References

  • 23960087