SubtiBank SubtiBank
bacE
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

bacE

efflux protein for bacilysin excretion, self-protection against bacilysin
locus
BSU_37700
pI
9.22
mw
43.26 kDa
protein length
394 aa Sequence Blast
gene length
1185 bp Sequence Blast
function
self-protection to bacilysin
product
efflux protein for bacilysin excretion
essential
no
synonyms
ywfF,ipa-84d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,869,487 3,870,671

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|3F49F4AEFC49C2883EFA60FEB3E77591F184195B|bacA]-[gene|0EEE23875DB720D256D53F00D1AD5EF24B538B27|bacB]-[gene|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|bacC]-[gene|2CE0C0484A70EEE40277996CD3D564A84FEAF5B3|bacD]-[gene|4D2AD84E74888EC61E44DE5B8E31812F43250B05|bacE]-[gene|99434727013FCCD6E570AE550560A8546F7F2A41|bacF]
    description
    [Pubmed|12372825]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|19801406], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12372825,21709425], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|12697329,21709425], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19801406], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • regulation

  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A513 (ywfF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/513 NBRP B. subtilis, Japan]
  • BKE37700 ([gene|4D2AD84E74888EC61E44DE5B8E31812F43250B05|bacE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTAGAGTTGGGTTTCAGCT, downstream forward: _UP4_ACGGAGCAAAAAGGAGTCTT
  • BKK37700 ([gene|4D2AD84E74888EC61E44DE5B8E31812F43250B05|bacE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTAGAGTTGGGTTTCAGCT, downstream forward: _UP4_ACGGAGCAAAAAGGAGTCTT
  • References

  • 15609023,12372825,19801406,21948839