SubtiBank SubtiBank
yodI
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yodI

unknown
locus
BSU_19610
pI
10.47
mw
9.06 kDa
protein length
gene length
252 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,134,244 2,134,495

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|65F2152BF78AEC10E921D46E62D472B7FA74FA3A|yodH]-[gene|4D3BF0A60B7FBF7CC8C97F8AEF5B3F2A2D41979C|yodI]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,15383836]
  • view in new tab

    genes
    [gene|4D3BF0A60B7FBF7CC8C97F8AEF5B3F2A2D41979C|yodI]
    description
    [Pubmed|22383849]

    regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,15383836]
  • view in new tab

    Biological materials

    Mutant

  • BKE19610 ([gene|4D3BF0A60B7FBF7CC8C97F8AEF5B3F2A2D41979C|yodI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATATTGTTCCCCTCCTAT, downstream forward: _UP4_TAAGCATAGAACAAATGCTA
  • BKK19610 ([gene|4D3BF0A60B7FBF7CC8C97F8AEF5B3F2A2D41979C|yodI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATATTGTTCCCCTCCTAT, downstream forward: _UP4_TAAGCATAGAACAAATGCTA
  • References

  • 15699190,15383836