SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


ribonuclease, extracellular RNase Bsn
31.94 kDa
protein length
288 aa Sequence Blast
gene length
867 bp Sequence Blast
extracellular RNA degradation
extracellular RNase Bsn

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.3|Phosphate metabolism]
  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW|Endoribonucleases]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    3,344,113 3,344,979

    The protein


  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|16291680], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|16291680]
  • view in new tab

    Biological materials


  • MGNA-A552 (yurI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32540 ([gene|4D46B2842D6B8B8002F47544E76DB36C24364E69|yurI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACTTGCCCTCCTTTTA, downstream forward: _UP4_TAAGAAAAAGGTGCTCCTTT
  • BKK32540 ([gene|4D46B2842D6B8B8002F47544E76DB36C24364E69|yurI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACTTGCCCTCCTTTTA, downstream forward: _UP4_TAAGAAAAAGGTGCTCCTTT
  • References


  • 31464530
  • Original Publications

  • 16291680,18957862,12490701,1396690,20709850,20817675,25666134