SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to molybdenum-binding protein
34.01 kDa
protein length
308 aa Sequence Blast
gene length
927 bp Sequence Blast

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Other transporters]
  • Gene

    3,424,235 3,425,161

    Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B064 (yvgK::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A994 ( ''yvgK''::''spec''), [Pubmed| ], available at [ BGSC]
  • 1A994 ( ''yvgK''::''spec''), [Pubmed| ], available at [ BGSC]
  • BKE33370 ([gene|4D49D6734595C3C83003A7EC2DA6F1E1BEBC8E19|yvgK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCATCACTCTCCTAT, downstream forward: _UP4_TAAAAAATCCCTCTTGATAG
  • BKK33370 ([gene|4D49D6734595C3C83003A7EC2DA6F1E1BEBC8E19|yvgK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCATCACTCTCCTAT, downstream forward: _UP4_TAAAAAATCCCTCTTGATAG