SubtiBank SubtiBank
yvgK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvgK

similar to molybdenum-binding protein
locus
BSU_33370
pI
6.36
mw
34.01 kDa
protein length
308 aa Sequence Blast
gene length
927 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yvsE

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • Gene

    Coordinates
    3,424,235 3,425,161

    Expression and Regulation

    Operons

    genes
    [gene|4D49D6734595C3C83003A7EC2DA6F1E1BEBC8E19|yvgK]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B064 (yvgK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1063 NBRP B. subtilis, Japan]
  • 1A994 ( ''yvgK''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A994&Search=1A994 BGSC]
  • 1A994 ( ''yvgK''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A994&Search=1A994 BGSC]
  • BKE33370 ([gene|4D49D6734595C3C83003A7EC2DA6F1E1BEBC8E19|yvgK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCATCACTCTCCTAT, downstream forward: _UP4_TAAAAAATCCCTCTTGATAG
  • BKK33370 ([gene|4D49D6734595C3C83003A7EC2DA6F1E1BEBC8E19|yvgK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCATCACTCTCCTAT, downstream forward: _UP4_TAAAAAATCCCTCTTGATAG