SubtiBank SubtiBank
mtlD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mtlD

mannitol-1-phosphate 5-dehydrogenase
locus
BSU_03990
pI
6.29
mw
40.31 kDa
protein length
373 aa Sequence Blast
gene length
1122 bp Sequence Blast
function
mannitol utilization
product
mannitol-1-phosphate 5-dehydrogenase
essential
no
ec
1.1.1.17
synonyms
mtlB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.10|Utilization of mannitol]
  • Gene

    Coordinates
    451,618 452,739

    The protein

    Catalyzed reaction/ biological activity

  • D-mannitol 1-phosphate + NAD+ --> β-D-fructose 6-phosphate + NADH (according to UniProt)
  • Protein family

  • mannitol dehydrogenase family (with [protein|A1C64447E0074B06C9210CC51680273FAAE703FA|UxaB], according to UniProt)
  • Structure

  • [PDB|3H2Z] (from ''Shigella flexneri 2a str. 2457t mutant'', 42% identity, 59% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|5291FEF41CA547223EDF9EBAFA38D3EE550ED3F3|mtlA]-[gene|EE4A4336E25F5DCAC89214F55CDE203AB47AA249|mtlF]-[gene|4D54898D405EA25A0C74B1F02A492143D49B7B07|mtlD]
    description
    [Pubmed|12897001]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22014119], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|MtlR]: activation, [Pubmed|20444094], in [regulon|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|MtlR regulon]
  • regulation

  • induced by mannitol ([protein|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|MtlR]) [Pubmed|20444094]
  • additional information

  • An [SW|ncRNA|antisense RNA] is predicted for [gene|4D54898D405EA25A0C74B1F02A492143D49B7B07|mtlD] [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C019 (mtlD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2017 NBRP B. subtilis, Japan]
  • BKE03990 ([gene|4D54898D405EA25A0C74B1F02A492143D49B7B07|mtlD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCACCGAAATGTAAGGCGA, downstream forward: _UP4_TAACCGACCACCCGTGACAC
  • BKK03990 ([gene|4D54898D405EA25A0C74B1F02A492143D49B7B07|mtlD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCACCGAAATGTAAGGCGA, downstream forward: _UP4_TAACCGACCACCCGTGACAC
  • References

  • 12897001,20444094,10627040,20525796