The second international online conference
#Subtillery2021 will be held 14th - 18th June - save the date, for more information see the
conference website!
The 21st
International Conference on Bacilli has been postponed to 2022 and will take place in Prague.
ydjB
Genomic Context
categories
[category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.5|Prophage 3][category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]Gene
Coordinates
663,601 663,936
Biological materials
Mutant
MGNA-C210 (ydjB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2208 NBRP B. subtilis, Japan]BKE06120 ([gene|4D5D0363035C8C3283BFCF36557CA23C0EB7B9A4|ydjB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAGACGAGTTCCTTA, downstream forward: _UP4_TAATTGAATCTCATATTCTTBKK06120 ([gene|4D5D0363035C8C3283BFCF36557CA23C0EB7B9A4|ydjB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAGACGAGTTCCTTA, downstream forward: _UP4_TAATTGAATCTCATATTCTT