SubtiBank SubtiBank
spoVFB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

spoVFB

dipicolinate synthase (subunit B)
locus
BSU_16740
pI
6.15
mw
21.72 kDa
protein length
200 aa Sequence Blast
gene length
603 bp Sequence Blast
function
dipicolic acid production
product
dipicolinate synthase (subunit B)
essential
no
synonyms
dpaB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.3|Biosynthesis of dipicolinate]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,745,263 1,745,865

    The protein

    Catalyzed reaction/ biological activity

  • (S)-2,3-dihydrodipicolinate + NADP+ --> dipicolinate + H+ + NADPH (according to UniProt)
  • Structure

  • [PDB|3MCU] (from B. cereus, 72% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|3DA80060554B78E9DC2189CECB78680095B08B32|spoVFA]-[gene|4D93A13DB9DC55A49525BFF4FD589F4FF67D50E8|spoVFB]-[gene|564A2F43F8AABE97FC8F0B1B3382A9F31F02FA18|asd]-[gene|6D6718AC72C9D86EDE16B191EDAB3ABA488B689B|dapG]-[gene|00B4CA4E25858A56F9D4E0ADEE2643F203FEC613|dapA]
    description
    [Pubmed|8098035]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,8098035], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,8098035]
  • view in new tab

    Biological materials

    Mutant

  • BKE16740 ([gene|4D93A13DB9DC55A49525BFF4FD589F4FF67D50E8|spoVFB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTCCTTTTAATGACGACA, downstream forward: _UP4_TAAATTTACAGAAAATCTTT
  • BKK16740 ([gene|4D93A13DB9DC55A49525BFF4FD589F4FF67D50E8|spoVFB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTCCTTTTAATGACGACA, downstream forward: _UP4_TAAATTTACAGAAAATCTTT
  • References

  • 8345520,8098035,15699190