SubtiBank SubtiBank
yxbD
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yxbD

unknown
locus
BSU_39870
pI
4.90
mw
17.93 kDa
protein length
159 aa Sequence Blast
gene length
480 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yxaR

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,095,356 4,095,835

    The protein

    [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 1-139) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|A9815CF5DA9D8852F387DAF94CC26E95F1E4AC25|yxbC]-[gene|4DB53AE08A4E4841D0411A5590CC09A6ECC8E74E|yxbD]
    description
    [Pubmed|10746760]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|15101989], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B767 (yxbD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1766 NBRP B. subtilis, Japan]
  • BKE39870 ([gene|4DB53AE08A4E4841D0411A5590CC09A6ECC8E74E|yxbD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCTCCTTTTAGC, downstream forward: _UP4_TAAAAGGCGCTCCTCTAAGG
  • BKK39870 ([gene|4DB53AE08A4E4841D0411A5590CC09A6ECC8E74E|yxbD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCTCCTTTTAGC, downstream forward: _UP4_TAAAAGGCGCTCCTCTAAGG
  • References

  • 10746760,14651647,15101989,12618455