SubtiBank SubtiBank
yxbD
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yxbD

unknown
locus
BSU_39870
pI
4.90
mw
17.93 kDa
protein length
159 aa Sequence Blast
gene length
480 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yxaR

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,095,356 4,095,835

    The protein

    [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 1-139) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|A9815CF5DA9D8852F387DAF94CC26E95F1E4AC25|yxbC]-[gene|4DB53AE08A4E4841D0411A5590CC09A6ECC8E74E|yxbD]
    description
    [Pubmed|10746760]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|15101989], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B767 (yxbD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1766 NBRP B. subtilis, Japan]
  • BKE39870 ([gene|4DB53AE08A4E4841D0411A5590CC09A6ECC8E74E|yxbD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCTCCTTTTAGC, downstream forward: _UP4_TAAAAGGCGCTCCTCTAAGG
  • BKK39870 ([gene|4DB53AE08A4E4841D0411A5590CC09A6ECC8E74E|yxbD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCTCCTTTTAGC, downstream forward: _UP4_TAAAAGGCGCTCCTCTAAGG
  • References

  • 10746760,14651647,15101989,12618455