SubtiBank SubtiBank
yabQ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yabQ

required for sporulation at a late stage
locus
BSU_00610
pI
10.74
mw
24.95 kDa
protein length
211 aa Sequence Blast
gene length
636 bp Sequence Blast
function
sporulation
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    68,515 69,150

    Phenotypes of a mutant

  • inactivation of ''[gene|4DEDB27C0162409571AB4A1BB17CFE400764AE45|yabQ]'' reduces sporulation efficiency to 0.1% that of wild type cells [Pubmed|26735940]
  • The protein

    [SW|Localization]

  • forespore outer membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|D6B1837075ECBEE1FEAC704DDB6795336092897F|yabM]-[gene|52D48F22CB53421EE30970D34B4861E2F8A5893D|yabN]-[gene|B0CB19A3E3E84E12BF42BB050394C8A059A89359|yabO]-[gene|035B5486A3887FC71ACC0A8FB43ED77DC44E12EA|yabP]-[gene|4DEDB27C0162409571AB4A1BB17CFE400764AE45|yabQ]-[gene|FE0E60B875E72AEF5174A89C7AE5556FF59B19D5|divIC]-[gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]
    description
    [Pubmed|11283287]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,11283287], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|12207695], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulation

  • expressed during sporulation ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|11283287]
  • view in new tab

    genes
    [gene|035B5486A3887FC71ACC0A8FB43ED77DC44E12EA|yabP]-[gene|4DEDB27C0162409571AB4A1BB17CFE400764AE45|yabQ]-[gene|FE0E60B875E72AEF5174A89C7AE5556FF59B19D5|divIC]-[gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]
    description
    [Pubmed|11283287]

    regulation

  • expressed during sporulation ([protein|search|SigE]) [Pubmed|11283287]
  • additional information

  • there are about 50,000 molecules of DivIC per cell [http://www.ncbi.nlm.nih.gov/sites/entrez/9426141 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B918 (yabQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1917 NBRP B. subtilis, Japan]
  • BKE00610 ([gene|4DEDB27C0162409571AB4A1BB17CFE400764AE45|yabQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTATAGAATTGTGTCGTCA, downstream forward: _UP4_AGATGAAAGGAGGACCGTCT
  • BKK00610 ([gene|4DEDB27C0162409571AB4A1BB17CFE400764AE45|yabQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTATAGAATTGTGTCGTCA, downstream forward: _UP4_AGATGAAAGGAGGACCGTCT
  • References

  • 11283287,10869437,15231775,26735940