SubtiBank SubtiBank
gamP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gamP

glucosamine-specific permease of the [SW|phosphotransferase systems|phosphotransferase system], EIICBA of the [category|SW 1.2.2|PTS]
locus
BSU_02350
pI
5.47
mw
67.97 kDa
protein length
631 aa Sequence Blast
gene length
1896 bp Sequence Blast
function
glucosamine uptake and phosphorylation
product
glucosamine-specific [category|SW 1.2.2|PTS], EIICBA
essential
no
ec
2.7.1.69
synonyms
ybfS,yzfA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.3|Utilization of cell wall components]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.17|Utilization of amino sugars]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.3|Utilization of amino sugars]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    254,907 256,802

    Phenotypes of a mutant

  • delayed growth with glucosamine as the single carbon source [Pubmed|10627040]
  • The protein

    Catalyzed reaction/ biological activity

  • protein EIIA Npi-phospho-L-histidine + protein EIIB --> protein EIIA + protein EIIB Npi-phospho-L-histidine/cysteine (according to UniProt)
  • Protein family

  • [category|SW 1.2.2|PTS] permease, glucose family [Pubmed|10627040]
  • Paralogous protein(s)

  • [protein|7D5A8084FDDA962CCF028FC3735E68C4F2E77084|NagP]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|8BBC9AFF4CD56A3A66E270A2BBA193D095EE01D1|gamA]-[gene|4DF1740D4DFB9FD25E77C14D28AEA01707776099|gamP]
    description
    [Pubmed|23667565]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23667565], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|GamR]: repression, [Pubmed|24673833,23667565], in [regulon|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|GamR regulon]
  • regulation

  • induced by glucosamine ([protein|search|GamR]) [Pubmed|24673833,23667565]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B937 (ybfS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1936 NBRP B. subtilis, Japan]
  • QB6098 (aphA3), available in [SW|Jörg Stülke]'s lab
  • BKE02350 ([gene|4DF1740D4DFB9FD25E77C14D28AEA01707776099|gamP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACAGTCTCCTTTTATT, downstream forward: _UP4_TAAAAAAGTCCCCCCTGCTG
  • BKK02350 ([gene|4DF1740D4DFB9FD25E77C14D28AEA01707776099|gamP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACAGTCTCCTTTTATT, downstream forward: _UP4_TAAAAAAGTCCCCCCTGCTG
  • References

  • 10627040,18763711,24673833,23667565,30038046