SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


general stress protein, broad specificity aldo-keto reductase that converts MG to acetol
37.16 kDa
protein length
331 aa Sequence Blast
gene length
996 bp Sequence Blast
detoxification of methylglyoxal
aldo/keto reductase, specific for NADP

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW|Biosynthesis of fatty acids]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    1,030,265 1,031,260

    Phenotypes of a mutant

  • increased sensitivity to methylglyoxal [Pubmed|24330391]
  • The protein

    Catalyzed reaction/ biological activity

  • methylglyoxal ---> acetol [Pubmed|24330391]
  • Protein family

  • [SW|Aldo/keto reductase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B73D729097C00BE6F3C7FF1708738783EE93C6FB|YccK], [protein|D0A2506FDCEA41D2A8910AC2837B46E0B311D63B|YcsN], [protein|F1AFFACD36C75702B0BB8F0B4241A9688FB6253C|IolS]
  • [SW|Cofactors]

  • NADPH [Pubmed|24330391]
  • Structure

  • [PDB|1PZ1] [Pubmed|15019785]
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|10220166,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|FCDE900167AE36377979E0CF7BC33C7F351B95D3|FapR]: repression, [Pubmed|12737802], in [regulon|FCDE900167AE36377979E0CF7BC33C7F351B95D3|FapR regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|10220166,15805528]
  • view in new tab

    Biological materials


  • MGNA-A695 (yhdN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE09530 ([gene|4DF9B105ABA64AFD5106EE75FCC9EFAB52BEFC83|yhdN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGCCACTCCTTCACT, downstream forward: _UP4_TAACAAAAGCTGAGGGCGAA
  • BKK09530 ([gene|4DF9B105ABA64AFD5106EE75FCC9EFAB52BEFC83|yhdN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGCCACTCCTTCACT, downstream forward: _UP4_TAACAAAAGCTGAGGGCGAA
  • References

  • 10220166,15019785,24330391,12737802,15805528