SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


general stress protein, broad specificity aldo-keto reductase that converts MG to acetol
37.16 kDa
protein length
331 aa Sequence Blast
gene length
996 bp Sequence Blast
detoxification of methylglyoxal
aldo/keto reductase, specific for NADP

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW|Biosynthesis of fatty acids]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    1,030,265 1,031,260

    Phenotypes of a mutant

  • increased sensitivity to methylglyoxal [Pubmed|24330391]
  • The protein

    Catalyzed reaction/ biological activity

  • methylglyoxal ---> acetol [Pubmed|24330391]
  • Protein family

  • [SW|Aldo/keto reductase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B73D729097C00BE6F3C7FF1708738783EE93C6FB|YccK], [protein|D0A2506FDCEA41D2A8910AC2837B46E0B311D63B|YcsN], [protein|F1AFFACD36C75702B0BB8F0B4241A9688FB6253C|IolS]
  • [SW|Cofactors]

  • NADPH [Pubmed|24330391]
  • Structure

  • [PDB|1PZ1] [Pubmed|15019785]
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|10220166,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|FCDE900167AE36377979E0CF7BC33C7F351B95D3|FapR]: repression, [Pubmed|12737802], in [regulon|FCDE900167AE36377979E0CF7BC33C7F351B95D3|FapR regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|10220166,15805528]
  • view in new tab

    Biological materials


  • MGNA-A695 (yhdN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE09530 ([gene|4DF9B105ABA64AFD5106EE75FCC9EFAB52BEFC83|yhdN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGCCACTCCTTCACT, downstream forward: _UP4_TAACAAAAGCTGAGGGCGAA
  • BKK09530 ([gene|4DF9B105ABA64AFD5106EE75FCC9EFAB52BEFC83|yhdN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGCCACTCCTTCACT, downstream forward: _UP4_TAACAAAAGCTGAGGGCGAA
  • References

  • 10220166,15019785,24330391,12737802,15805528