SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


may be involved in spore killing
56.00 kDa
protein length
496 aa Sequence Blast
gene length
1491 bp Sequence Blast
may be involved in spore killing

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.4|Prophage 1]
  • Gene

    215,404 216,894

    Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16452424], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [PubMed|14651647,15687200], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|15687200,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|16816204], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [,15687200 PubMed]
  • additional information

  • Northern blotting during during phosphate limitation showed an intense 0.25 kb '[protein|DDB0022F50999AC52809D651C9CC5A5FDC71302C|SkfA]'-specific transcript, and a weaker 6.5 kb [gene|DDB0022F50999AC52809D651C9CC5A5FDC71302C|skfA]-[gene|F981C605C652D1A4429579A5F24608CE7F570834|skfB]-[gene|4DFF9924E07D834F37580D73E88451C1671C5111|skfC]-[gene|5886364199844356446C08F08664B301A714E74A|skfE]-[gene|77D93CAEF46EBBB9BAF570714445E194D5F2884E|skfF]-[gene|527AB8EAAF0A1AAD4E5B714B35ED9F78BECC17EC|skfG]-[gene|F31B12F80AFC3580FD33811A1C22E74F75DC1A85|skfH] transcript
  • view in new tab

    Biological materials


  • MGNA-C514 (ybcS::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE01935 ([gene|4DFF9924E07D834F37580D73E88451C1671C5111|skfC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCAGAACACCAATGATAGAC, downstream forward: _UP4_CTCTAATGATTAGGAGAAGA
  • BKK01935 ([gene|4DFF9924E07D834F37580D73E88451C1671C5111|skfC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCAGAACACCAATGATAGAC, downstream forward: _UP4_CTCTAATGATTAGGAGAAGA
  • References


  • 20955377
  • Original Publications

  • 12817086,15812018,16816204,14651647,15687200,15687200,17720793,17449691,18840696,27766092