SubtiBank SubtiBank
skfC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

skfC

may be involved in spore killing
locus
BSU_01935
pI
8.00
mw
56.00 kDa
protein length
496 aa Sequence Blast
gene length
1491 bp Sequence Blast
function
may be involved in spore killing
product
unknown
essential
no
synonyms
ybcS

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.4|Prophage 1]
  • Gene

    Coordinates
    215,404 216,894

    Expression and Regulation

    Operons

    genes
    [gene|DDB0022F50999AC52809D651C9CC5A5FDC71302C|skfA]-[gene|F981C605C652D1A4429579A5F24608CE7F570834|skfB]-[gene|4DFF9924E07D834F37580D73E88451C1671C5111|skfC]-[gene|5886364199844356446C08F08664B301A714E74A|skfE]-[gene|77D93CAEF46EBBB9BAF570714445E194D5F2884E|skfF]-[gene|527AB8EAAF0A1AAD4E5B714B35ED9F78BECC17EC|skfG]-[gene|F31B12F80AFC3580FD33811A1C22E74F75DC1A85|skfH]
    description
    [Pubmed|16816204]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16452424], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [PubMed|14651647,15687200], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|15687200,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|16816204], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [http://www.ncbi.nlm.nih.gov/sites/entrez/14651647,15687200 PubMed]
  • additional information

  • Northern blotting during during phosphate limitation showed an intense 0.25 kb '[protein|search|skfA]'-specific transcript, and a weaker 6.5 kb '[protein|search|skfA]-[protein|search|skfB]-[protein|search|skfC]-[protein|search|skfE]-[protein|search|skfF]-[protein|search|skfG]-[protein|search|skfH]' transcript.
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C514 (ybcS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2512 NBRP B. subtilis, Japan]
  • BKE01935 ([gene|4DFF9924E07D834F37580D73E88451C1671C5111|skfC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01935 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCAGAACACCAATGATAGAC, downstream forward: _UP4_CTCTAATGATTAGGAGAAGA
  • BKK01935 ([gene|4DFF9924E07D834F37580D73E88451C1671C5111|skfC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01935 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCAGAACACCAATGATAGAC, downstream forward: _UP4_CTCTAATGATTAGGAGAAGA
  • References

    Reviews

  • 20955377
  • Original Publications

  • 12817086,15812018,16816204,14651647,15687200,15687200,17720793,17449691,18840696,27766092