SubtiBank SubtiBank
ribE
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ribE

riboflavin synthase (alpha subunit)
locus
BSU_23270
pI
5.84
mw
23.33 kDa
protein length
215 aa Sequence Blast
gene length
648 bp Sequence Blast
function
riboflavin biosynthesis
product
riboflavin synthase (alpha subunit)
essential
no
ec
2.5.1.9
synonyms
ribB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.2|Biosynthesis/ acquisition of riboflavin/ FAD]
  • Gene

    Coordinates
    2,429,600 2,430,247

    The protein

    Catalyzed reaction/ biological activity

  • 2 6,7-dimethyl-8-(1-D-ribityl)lumazine + H+ --> 5-amino-6-(D-ribitylamino)uracil + riboflavin (according to UniProt)
  • Structure

  • [PDB|1I8D] (from ''E. coli'', 36% identity, 59% similarity) [Pubmed|11377200], , [PDB|1RVV] (the [protein|4E18BD4B084094EE4FBC8FE2AC95B14581D20C0F|RibE])3-([protein|2A5DCBFAB51996F0DDEC964D5D178274AF86CE69|RibH])60 lumazine synthase/riboflavin synthase complex) [Pubmed|7473709]
  • Expression and Regulation

    Operons

    genes
    [gene|3DFCF7C5FE15C9A3E9E7E4B0DA8E926B85DBD180|ribD]-[gene|4E18BD4B084094EE4FBC8FE2AC95B14581D20C0F|ribE]-[gene|F07B7062C850106A95C15978E36DA500F8B089D6|ribA]-[gene|2A5DCBFAB51996F0DDEC964D5D178274AF86CE69|ribH]-[gene|8146A052E4E7844F781E7169C264EC927DEB7387|ribT]
    description
    [Pubmed|8159171]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8159171], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|FMN-box|FMN-box]: transcription termination, via [SW|FMN-box] in the presence of FMN or FMNH2, this is counter-acted upon binding of [protein|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|RibR], in [regulon|FMN-box|FMN-box]
  • regulation

  • expressed in the absence of FMN ([SW|FMN-box]) [Pubmed|15808508]
  • binding of FMN to the [SW|FMN-box] RNA is facilitated by [protein|43CFA3477B4EEB4CE0B2DF63ED2B5EDB171E79C7|NusG]-mediated transcription pausing [pubmed|32817529]
  • the [SW|FMN-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • GP203 (erm), available in [SW|Jörg Stülke]'s lab
  • BKE23270 ([gene|4E18BD4B084094EE4FBC8FE2AC95B14581D20C0F|ribE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTCCTGTAAACATGGTCA, downstream forward: _UP4_GGCTTTTAGAGAGGAAGATT
  • BKK23270 ([gene|4E18BD4B084094EE4FBC8FE2AC95B14581D20C0F|ribE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTCCTGTAAACATGGTCA, downstream forward: _UP4_GGCTTTTAGAGAGGAAGATT
  • References

    Reviews

  • 11395405
  • Original publications

  • 12456892,15808508,11377200,8159171,7934830,7473709,23270261,24442413,26494285,29087189