SubtiBank SubtiBank
gabT
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

gabT

gamma-aminobutyrate transaminase, general stress protein
locus
BSU03900
pI
5.30
mw
47.09 kDa
protein length
436 aa Sequence Blast
gene length
1308 bp Sequence Blast
function
utilization of gamma-amino butyric acid
product
gamma-aminobutyrate transaminase
essential
no
ec
2.6.1.19
synonyms
ycnG

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.10|Utilization of gamma-amino butyric acid]
  • Gene

    Coordinates
    441,571 → 442,881

    Phenotypes of a mutant

  • growth defect in the presence of gamma-aminobutyrate [Pubmed|24127574]
  • no growth with gamma-aminobutyrate as single carbon source [Pubmed|24529384]
  • The protein

    Catalyzed reaction/ biological activity

  • 4-aminobutanoate + 2-oxoglutarate = succinate semialdehyde + L-glutamate (according to Swiss-Prot)
  • the protein was reported to be involved in norspermidine production and biofilm disassembly [Pubmed|22541437]; however, this is not the case [Pubmed|24529384]and the original paper has been [http://www.cell.com/cell/fulltext/S0092-8674(15)00495-X retracted]
  • Protein family

  • class-III pyridoxal-phosphate-dependent aminotransferase family (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|4E1FD02C6FE4103E3B4942BF5221C062CB8D0B9B|gabT]-[gene|A0BEB92D54799956A4ADE106A1388E5710141069|gabD]
    description
    [Pubmed|12123465]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12123465], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|GabR]: activation, [Pubmed|12123465], in [regulon|C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|GabR regulon]
  • regulation

  • ''[protein|search|gabD]'': induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C068 (ycnG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2066 NBRP B. subtilis, Japan]
  • BKE03900 (Δ[gene|4E1FD02C6FE4103E3B4942BF5221C062CB8D0B9B|gabT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGAATATCCCCCTGTC, downstream forward: _UP4_TAATCATTGGAAAGAAAATG
  • BKK03900 (Δ[gene|4E1FD02C6FE4103E3B4942BF5221C062CB8D0B9B|gabT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGAATATCCCCCTGTC, downstream forward: _UP4_TAATCATTGGAAAGAAAATG
  • Labs working on this gene/protein

  • [SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
  • References

  • 15223311,12123465,22541437,24529384,4590473,26681693