SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


gamma-aminobutyrate transaminase, general stress protein
47.09 kDa
protein length
436 aa Sequence Blast
gene length
1308 bp Sequence Blast
utilization of gamma-amino butyric acid
gamma-aminobutyrate transaminase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of gamma-amino butyric acid]
  • Gene

    441,571 → 442,881

    Phenotypes of a mutant

  • growth defect in the presence of gamma-aminobutyrate [Pubmed|24127574]
  • no growth with gamma-aminobutyrate as single carbon source [Pubmed|24529384]
  • The protein

    Catalyzed reaction/ biological activity

  • 4-aminobutanoate + 2-oxoglutarate = succinate semialdehyde + L-glutamate (according to Swiss-Prot)
  • the protein was reported to be involved in norspermidine production and biofilm disassembly [Pubmed|22541437]; however, this is not the case [Pubmed|24529384]and the original paper has been [ retracted]
  • Protein family

  • class-III pyridoxal-phosphate-dependent aminotransferase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|E5F6DF14A4C01B2C90F70E37908D3697BC1B5FEF|YhxA]:
  • Structure

  • [PDB|1SF2] (from E. coli, 45% identity) [pubmed|15323550]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12123465], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|GabR]: activation, [Pubmed|12123465], in [regulon|C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|GabR regulon]
  • regulation

  • ''[protein|search|gabD]'': induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials


  • MGNA-C068 (ycnG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE03900 (Δ[gene|4E1FD02C6FE4103E3B4942BF5221C062CB8D0B9B|gabT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGAATATCCCCCTGTC, downstream forward: _UP4_TAATCATTGGAAAGAAAATG
  • BKK03900 (Δ[gene|4E1FD02C6FE4103E3B4942BF5221C062CB8D0B9B|gabT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGAATATCCCCCTGTC, downstream forward: _UP4_TAATCATTGGAAAGAAAATG
  • Labs working on this gene/protein

  • [SW|Linc Sonenshein], Tufts University, Boston, MA, USA [ Homepage]
  • References

  • 15223311,12123465,22541437,24529384,4590473,26681693,15323550