SubtiBank SubtiBank
yckE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yckE

aryl--glucosidase
locus
BSU_03410
pI
5.57
mw
54.97 kDa
protein length
477 aa Sequence Blast
gene length
1434 bp Sequence Blast
function
utilization of aryl--glucosides
product
aryl--glucosidase
essential
no
ec
3.2.1.86
synonyms
bglC

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.18|Utilization of beta-glucosides]
  • Gene

    Coordinates
    370,259 371,692

    The protein

    Catalyzed reaction/ biological activity

  • 6-phospho-β-D-glucosyl-(1→4)-D-glucose + H2O --> D-glucose + D-glucose 6-phosphate (according to UniProt)
  • Protein family

  • [SW|glycosyl hydrolase 1 family] (according to UniProt)
  • Structure

  • [PDB|4ZE4] (from Geobacillus stearothermophilus, 72% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|4E626CEED2AB27442B49C199CAFDA89333D44715|yckE]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C055 (yckE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2053 NBRP B. subtilis, Japan]
  • BKE03410 ([gene|4E626CEED2AB27442B49C199CAFDA89333D44715|yckE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTGTTTATCACTCCTG, downstream forward: _UP4_TAAAGAGTCCCTGAGAGTTA
  • BKK03410 ([gene|4E626CEED2AB27442B49C199CAFDA89333D44715|yckE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTGTTTATCACTCCTG, downstream forward: _UP4_TAAAGAGTCCCTGAGAGTTA
  • References

  • 14652714,15139916,18069788