SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


54.97 kDa
protein length
477 aa Sequence Blast
gene length
1434 bp Sequence Blast
utilization of aryl--glucosides

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of beta-glucosides]
  • Gene

    370,259 371,692

    The protein

    Catalyzed reaction/ biological activity

  • 6-phospho-β-D-glucosyl-(1→4)-D-glucose + H2O --> D-glucose + D-glucose 6-phosphate (according to UniProt)
  • Protein family

  • [SW|glycosyl hydrolase 1 family] (according to UniProt)
  • Structure

  • [PDB|4ZE4] (from Geobacillus stearothermophilus, 72% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C055 (yckE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE03410 ([gene|4E626CEED2AB27442B49C199CAFDA89333D44715|yckE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTGTTTATCACTCCTG, downstream forward: _UP4_TAAAGAGTCCCTGAGAGTTA
  • BKK03410 ([gene|4E626CEED2AB27442B49C199CAFDA89333D44715|yckE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTGTTTATCACTCCTG, downstream forward: _UP4_TAAAGAGTCCCTGAGAGTTA
  • References

  • 14652714,15139916,18069788