SubtiBank SubtiBank
glnL
The papers of the month are back! Check them out! Link here

glnL

two-component response regulator, regulation of the glsA-glnT operon
locus
BSU02450
pI
7.02
mw
35.56 kDa
protein length
314 aa Sequence Blast
gene length
942 bp Sequence Blast
function
regulation of the glsA-glnT operon
product
two-component response regulator
essential
no
synonyms
ycbB, yzgB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.1|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.1|Utilization of glutamine/ glutamate]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.1|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    Coordinates
    266,719 → 267,663

    The protein

    Modification

  • phosphorylated by [protein|C18B886D06879C64B64606371E85A7D4D22DCFAC|GlnK] on an Asp residue
  • Effectors of protein activity

  • phosphorylation likely affects DNA-binding activity
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Biological materials

    Mutant

  • MGNA-C026 (ycbB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2024 NBRP B. subtilis, Japan]
  • BKE02450 (Δ[gene|4E6EA2EABBDAA427E8F9EE1AE1800AF8657CF18B|glnL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCTTTTGGTTCACCCT, downstream forward: _UP4_TAAACCAAACAGCCGGCTGA
  • BKK02450 (Δ[gene|4E6EA2EABBDAA427E8F9EE1AE1800AF8657CF18B|glnL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCTTTTGGTTCACCCT, downstream forward: _UP4_TAAACCAAACAGCCGGCTGA
  • References

  • 10094672,15995196