SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


23.19 kDa
protein length
208 aa Sequence Blast
gene length
627 bp Sequence Blast
control of [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW] activity

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    195,426 196,052

    The protein

    Protein family

  • zinc-associated anti-sigma factor (ZAS) superfamily (with [protein|B454D14B33E2C11F0BB0A1D1BB743FA64981A966|YlaD], according to UniProt)
  • anti-sigma-W factor family (single member, according to UniProt)
  • [SW|Domains]

  • The cytoplasmic domain is able to inactivate SigW and the extracellular and transmembrane domains are crucial for sensing and transducing the signal that triggers SigW activation (PubMed:15130127). The N-terminus binds the zinc ion and is followed by a long helix (about residues 40-80) that fits into a hydrophobic surface groove on SigW, probably blocking its ability to interact with the -10 and -35 promoter elements (PubMed:28319136).
  • Effectors of protein activity

  • degraded by [protein|CB50289535EA537F63BADD459BD11AA7759A6658|RasP] and [protein|EE3B6B52EA19958E2E46A1545747F5209A6AA036|PrsW] under conditions of alkali shock or in the presence of antimicrobial peptides, respectively. This results in the release of [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]
  • Structure

  • [PDB|5WUQ] (the cytoplasmic domain in complex with [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]) [pubmed|28319136]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|12076816], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced under conditions of alkali shock or in the presence of the toxin [protein|search|SdpC] ([protein|search|SigW]) [Pubmed|12207695]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [ PubMed]
  • view in new tab

    Biological materials


  • MGNA-B953 (ybbM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE01740 ([gene|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|rsiW]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGACAGCTCATTTCATCAC, downstream forward: _UP4_TAAAGCGCGTTAGCCGCTTT
  • BKK01740 ([gene|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|rsiW]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGACAGCTCATTTCATCAC, downstream forward: _UP4_TAAAGCGCGTTAGCCGCTTT
  • labs

  • [SW|Thomas Wiegert], University of Bayreuth, Germany [ Homepage]
  • References


  • 20836086,22381678,29343670
  • Original Publications

  • 17020587,14993308,16816000,18599827,12207695,16899079,15130127,12884008,12076816,19889088,14993308,28319136,28674070