SubtiBank SubtiBank
dsdA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

dsdA

D-serine deaminase
locus
BSU_23770
pI
5.55
mw
49.50 kDa
protein length
448 aa Sequence Blast
gene length
1344 bp Sequence Blast
function
unknown
product
D-serine deaminase
essential
no
ec
4.3.1.18
synonyms
yqjR

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,469,580 → 2,470,926

    The protein

    Catalyzed reaction/ biological activity

  • D-serine --> NH4+ + pyruvate (according to UniProt)
  • Protein family

  • serine/threonine dehydratase family (with [protein|D0CF32BF81AA1DC7BBBC3E9B667A54F97260DF3F|IlvA], according to UniProt)
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|3SS7] (from E. coli, 58% identity) [pubmed|22197591]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|35B40D812B123766B469B8E5C0FE0EB69F671E4E|yqjP]-[gene|0927C7D45721F47F5ED2646CAAC324A308FD7724|yqjQ]-[gene|4E7390A74A8261E8B732E94859E90FE256AD64EE|dsdA]-[gene|B3362449EF3C9D533090FBD7E7333A3CC5D902CB|coaA]-[gene|441DCE4251C83FCBB01BC58720900365BFE7BB3D|yqjT]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C398 (yqjR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2396 NBRP B. subtilis, Japan]
  • BKE23770 (Δ[gene|4E7390A74A8261E8B732E94859E90FE256AD64EE|dsdA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAACAATCTCTCCCTT, downstream forward: _UP4_TAAGCAGACAGTGAAAAGGT
  • BKK23770 (Δ[gene|4E7390A74A8261E8B732E94859E90FE256AD64EE|dsdA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAACAATCTCTCCCTT, downstream forward: _UP4_TAAGCAGACAGTGAAAAGGT
  • References

  • 3098560,22197591