SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


D-serine deaminase
49.50 kDa
protein length
448 aa Sequence Blast
gene length
1344 bp Sequence Blast
D-serine deaminase

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    2,469,580 → 2,470,926

    The protein

    Catalyzed reaction/ biological activity

  • D-serine --> NH4+ + pyruvate (according to UniProt)
  • Protein family

  • serine/threonine dehydratase family (with [protein|D0CF32BF81AA1DC7BBBC3E9B667A54F97260DF3F|IlvA], according to UniProt)
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|3SS7] (from E. coli, 58% identity) [pubmed|22197591]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C398 (yqjR::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE23770 (Δ[gene|4E7390A74A8261E8B732E94859E90FE256AD64EE|dsdA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAACAATCTCTCCCTT, downstream forward: _UP4_TAAGCAGACAGTGAAAAGGT
  • BKK23770 (Δ[gene|4E7390A74A8261E8B732E94859E90FE256AD64EE|dsdA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAACAATCTCTCCCTT, downstream forward: _UP4_TAAGCAGACAGTGAAAAGGT
  • References

  • 3098560,22197591