SubtiBank SubtiBank
cssS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cssS

two-component sensor kinase, control of cellular responses to protein secretion stress
locus
BSU_33020
pI
5.80
mw
51.92 kDa
protein length
451 aa Sequence Blast
gene length
1356 bp Sequence Blast
function
control of cellular responses to protein secretion stress
product
two-component sensor kinase
essential
no
synonyms
yvqB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.1|Two-component sensor kinase]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    3,386,398 3,387,753

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|A40CD2C23A19860342F440284302EFFDAC09E88A|CssR]
  • ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
  • Paralogous protein(s)

  • [protein|52BB660B0CAB36C74F1D47963235846B45AF78AB|YclK], [protein|96E4470EF4B558F4EC318FEBF58B779BA50DB7E2|YvrG], [protein|9E8A6AB3920BFBFDAAD1F2E4F333A32354ABB25B|YkoH], [protein|1582E81F7DA85F38D6732D341ABD0F052587F25A|KinE]
  • [SW|Domains]

  • two transmembrane segments, C-terminal histidine phosphotransferase domain
  • Modification

  • autophosphorylation on a His residue
  • Effectors of protein activity

  • the extracellular loop domain is required for signal perception [Pubmed|22307758]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • localized primarily at the division septum but also found in a punctate pattern with lower intensity throughout the cell cylinder [Pubmed|22307758]
  • Expression and Regulation

    Operons

    genes
    [gene|A40CD2C23A19860342F440284302EFFDAC09E88A|cssR]-[gene|4EE48E4931F662E51586DB6D01E91C688329222D|cssS]
    description
    [Pubmed|11555295]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12270824], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|A40CD2C23A19860342F440284302EFFDAC09E88A|CssR]: activation, [Pubmed|12270824], in [regulon|A40CD2C23A19860342F440284302EFFDAC09E88A|CssR regulon]
  • regulation

  • expressed under conditions of secretion stress ([protein|search|CssR]) [Pubmed|12270824]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B216 (yvqB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1215 NBRP B. subtilis, Japan]
  • BKE33020 ([gene|4EE48E4931F662E51586DB6D01E91C688329222D|cssS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATGATGACATCATCCT, downstream forward: _UP4_TAGACTGTAGATGTTTTGCA
  • BKK33020 ([gene|4EE48E4931F662E51586DB6D01E91C688329222D|cssS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATGATGACATCATCCT, downstream forward: _UP4_TAGACTGTAGATGTTTTGCA
  • References

    Reviews

  • 27518094
  • Original Publications

  • 10094672,17600057,21630458,17088376,12270824,11555295,19820159,21602801,21624103,22307758