SubtiBank SubtiBank
yubC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yubC

cysteine dioxygenase
locus
BSU_31140
pI
5.05
mw
17.98 kDa
protein length
161 aa Sequence Blast
gene length
486 bp Sequence Blast
function
unknown
product
cysteine dioxygenase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,193,863 3,194,348

    The protein

    Catalyzed reaction/ biological activity

  • L-cysteine + O2 --> 3-sulfino-L-alanine + H+ (according to UniProt)
  • Protein family

  • cysteine dioxygenase family (single membran, according to UniProt)
  • Structure

  • [PDB|3EQE]
  • [http://pdb.org/pdb/explore/explore.do?structureId=4qm8 4QM8] [Pubmed|25307852], [PDB|4QM9] (from Bacillus Subtilis 100% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|4F296CA0094B8618224F998E1B382470EECEAB3C|yubC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A225 (yubC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/225 NBRP B. subtilis, Japan]
  • BKE31140 ([gene|4F296CA0094B8618224F998E1B382470EECEAB3C|yubC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGTTTTTGCCTCCCTT, downstream forward: _UP4_TGATTGACAGATAAACTGCT
  • BKK31140 ([gene|4F296CA0094B8618224F998E1B382470EECEAB3C|yubC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGTTTTTGCCTCCCTT, downstream forward: _UP4_TGATTGACAGATAAACTGCT
  • References

  • 25307852,22383849