SubtiBank SubtiBank
maeA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

maeA

malic enzyme, required for malate dependent catabolite repression of the [gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]-[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB] operon
locus
BSU_37050
pI
4.88
mw
63.93 kDa
protein length
582 aa Sequence Blast
gene length
1749 bp Sequence Blast
function
malate utilization
product
NAD-dependent malate dehydrogenase
essential
no
ec
1.1.1.38
synonyms
ywkA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • Gene

    Coordinates
    3,800,418 3,802,166

    The protein

    Catalyzed reaction/ biological activity

  • (S)-malate + NAD+ --> CO2 + NADH + pyruvate (according to UniProt)
  • H+ + oxaloacetate --> CO2 + pyruvate (according to UniProt)
  • Protein family

  • [SW|malic enzymes family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|BBBCD5F56779895189E21076AF165B901F654534|MalS]
  • [SW|Cofactors]

  • NAD+
  • Structure

  • [PDB|1LLQ] (from Ascaris suum, 41% identity) [pubmed|12033925]
  • Expression and Regulation

    Operons

    genes
    [gene|4F30A4412768E6313F57BD56C4EF5079F500E0C4|maeA]-[gene|1E602BCB2A416CDBF2B5007765EC9628123FE979|ywkB]
    description
    [Pubmed|12949160]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12949160], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|MalR]: activation, [Pubmed|12949160], in [regulon|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|MalR regulon]
  • regulation

  • expressed in the presence of malate ([protein|search|MalR]) [Pubmed|12949160]
  • additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B657 (ywkA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1656 NBRP B. subtilis, Japan]
  • GP1141 (aphA3) available in [SW|Jörg Stülke]'s lab
  • BKE37050 ([gene|4F30A4412768E6313F57BD56C4EF5079F500E0C4|maeA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAAAATATGACCGATC, downstream forward: _UP4_TAATTAGCGAGTAAATTTTT
  • BKK37050 ([gene|4F30A4412768E6313F57BD56C4EF5079F500E0C4|maeA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAAAATATGACCGATC, downstream forward: _UP4_TAATTAGCGAGTAAATTTTT
  • labs

  • [SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
  • References

  • 21815947,23136871,12949160,16788182,28974613,12033925