SubtiBank SubtiBank
maeA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

maeA

malic enzyme, required for malate dependent catabolite repression of the [gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]-[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB] operon
locus
BSU_37050
pI
4.88
mw
63.93 kDa
protein length
582 aa Sequence Blast
gene length
1749 bp Sequence Blast
function
malate utilization
product
NAD-dependent malate dehydrogenase
essential
no
ec
1.1.1.38
synonyms
ywkA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • Gene

    Coordinates
    3,800,418 3,802,166

    The protein

    Catalyzed reaction/ biological activity

  • (S)-malate + NAD+ --> CO2 + NADH + pyruvate (according to UniProt)
  • H+ + oxaloacetate --> CO2 + pyruvate (according to UniProt)
  • Protein family

  • [SW|malic enzymes family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|BBBCD5F56779895189E21076AF165B901F654534|MalS]
  • [SW|Cofactors]

  • NAD+
  • Structure

  • [PDB|1LLQ] (from Ascaris suum, 41% identity) [pubmed|12033925]
  • Expression and Regulation

    Operons

    genes
    [gene|4F30A4412768E6313F57BD56C4EF5079F500E0C4|maeA]-[gene|1E602BCB2A416CDBF2B5007765EC9628123FE979|ywkB]
    description
    [Pubmed|12949160]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12949160], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|MalR]: activation, [Pubmed|12949160], in [regulon|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|MalR regulon]
  • regulation

  • expressed in the presence of malate ([protein|search|MalR]) [Pubmed|12949160]
  • additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B657 (ywkA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1656 NBRP B. subtilis, Japan]
  • GP1141 (aphA3) available in [SW|Jörg Stülke]'s lab
  • BKE37050 ([gene|4F30A4412768E6313F57BD56C4EF5079F500E0C4|maeA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAAAATATGACCGATC, downstream forward: _UP4_TAATTAGCGAGTAAATTTTT
  • BKK37050 ([gene|4F30A4412768E6313F57BD56C4EF5079F500E0C4|maeA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAAAATATGACCGATC, downstream forward: _UP4_TAATTAGCGAGTAAATTTTT
  • labs

  • [SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
  • References

  • 21815947,23136871,12949160,16788182,28974613,12033925