SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


pyrimidine nucleoside transport protein
42.37 kDa
protein length
393 aa Sequence Blast
gene length
1182 bp Sequence Blast
pyrimidine uptake
pyrimidine nucleoside transport protein

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Nucleotide/ nucleoside transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    4,050,340 4,051,521

    The protein

    Protein family

  • concentrative nucleoside transporter (CNT) (TC 2.A.41) family (with [protein|7D4CF2FF4108D3AE170C1EE3C7D494EAD46699C6|YutK] and [protein|C333F405F597FF260FFA0EC616B8CF6BF454815B|NupG], according to UniProt)
  • Structure

  • [PDB|3TIJ] (from Vibrio cholerae, 33% identity) [pubmed|22407322]
  • [SW|Localization]

  • membrane protein [Pubmed|18763711]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8550462], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E9C4C569F18B3335DA9C7FB5B17C87D661E62669|DeoR]: repression, [Pubmed|8550462], in [regulon|E9C4C569F18B3335DA9C7FB5B17C87D661E62669|DeoR regulon]
  • regulation

  • induced by deoxynucleotides ([protein|search|DeoR]) [Pubmed|8550462]
  • view in new tab

    Biological materials


  • BKE39410 ([gene|4F718681A7AD0C86B2551248570F493AC0B2E7E9|nupC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTGTTTCTCCTTTAT, downstream forward: _UP4_TGAACTTAATCGAAAAGGAT
  • BKK39410 ([gene|4F718681A7AD0C86B2551248570F493AC0B2E7E9|nupC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTGTTTCTCCTTTAT, downstream forward: _UP4_TGAACTTAATCGAAAAGGAT
  • References

  • 11065368,8550462,10074062,18763711,10666464,22407322